Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220752536:

Variant ID: vg0220752536 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20752536
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTCAAGGAAGACGAAAAGCGGCGGAGGATCCGACGGAGAAGGCGACGTGGGCGAGGTTGACGGGAGAGAGGAGGCAGCGCGGGTGAGGTTGGCGGGGG[G/A]
AGGCGGGAGGAAGCAGCGTGGGCGAGGGAGCTCGTGGAAGAGGAGGCGGCATCGACGGGGAGAGGAGGCGACGTGAGCGAGGGAGCGTGCCCGATATTTT

Reverse complement sequence

AAAATATCGGGCACGCTCCCTCGCTCACGTCGCCTCCTCTCCCCGTCGATGCCGCCTCCTCTTCCACGAGCTCCCTCGCCCACGCTGCTTCCTCCCGCCT[C/T]
CCCCCGCCAACCTCACCCGCGCTGCCTCCTCTCTCCCGTCAACCTCGCCCACGTCGCCTTCTCCGTCGGATCCTCCGCCGCTTTTCGTCTTCCTTGACGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	3.80%	8.74%	4.63%	NA
All Indica	2759	77.40%	0.30%	14.46%	7.79%	NA
All Japonica	1512	88.00%	11.30%	0.53%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	60.00%	0.00%	33.61%	6.39%	NA
Indica II	465	83.20%	0.60%	11.18%	4.95%	NA
Indica III	913	87.00%	0.00%	4.93%	8.11%	NA
Indica Intermediate	786	76.10%	0.80%	12.98%	10.18%	NA
Temperate Japonica	767	77.20%	21.90%	0.78%	0.13%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	1.10%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220752536	G -> A	LOC_Os02g34600.1	upstream_gene_variant ; 1157.0bp to feature; MODIFIER	silent_mutation	Average:72.257; most accessible tissue: Zhenshan97 young leaf, score: 86.542	N	N	N	N
vg0220752536	G -> A	LOC_Os02g34600.2	upstream_gene_variant ; 1157.0bp to feature; MODIFIER	silent_mutation	Average:72.257; most accessible tissue: Zhenshan97 young leaf, score: 86.542	N	N	N	N
vg0220752536	G -> A	LOC_Os02g34610.1	downstream_gene_variant ; 372.0bp to feature; MODIFIER	silent_mutation	Average:72.257; most accessible tissue: Zhenshan97 young leaf, score: 86.542	N	N	N	N
vg0220752536	G -> A	LOC_Os02g34600-LOC_Os02g34610	intergenic_region ; MODIFIER	silent_mutation	Average:72.257; most accessible tissue: Zhenshan97 young leaf, score: 86.542	N	N	N	N
vg0220752536	G -> DEL	N	N	silent_mutation	Average:72.257; most accessible tissue: Zhenshan97 young leaf, score: 86.542	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220752536	4.03E-07	4.03E-07	mr1499_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220752536	1.73E-06	2.29E-08	mr1576_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220752536	NA	6.61E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251