\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220610874:

Variant ID: vg0220610874 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20610874
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTTAAGTAGGAATACAATTTTTGAAACAATTAAAATTGGAAATAAAAAATAAATATTAAAAGAGTAATCTATATAGAACACAATATGAGATTAATTA[A/C]
AATTTGAAATAAAAAATAAAATAAATTCAGAAAATAAGAGCTCAACTAGAATGCAATTTATAAATAACTAAAATTTGTAATAAAAAATAAAGACTATTGA

Reverse complement sequence

TCAATAGTCTTTATTTTTTATTACAAATTTTAGTTATTTATAAATTGCATTCTAGTTGAGCTCTTATTTTCTGAATTTATTTTATTTTTTATTTCAAATT[T/G]
TAATTAATCTCATATTGTGTTCTATATAGATTACTCTTTTAATATTTATTTTTTATTTCCAATTTTAATTGTTTCAAAAATTGTATTCCTACTTAAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.60% 0.32% 0.02% NA
All Indica  2759 98.80% 1.10% 0.18% 0.00% NA
All Japonica  1512 99.30% 0.00% 0.66% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.10% 0.51% 0.00% NA
Temperate Japonica  767 98.80% 0.00% 1.04% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220610874 A -> C LOC_Os02g34410-LOC_Os02g34430 intergenic_region ; MODIFIER N Average:18.81; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220610874 NA 5.61E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 9.66E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 8.57E-07 mr1063_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 2.23E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 3.90E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 2.52E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220610874 NA 1.73E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251