\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220527488:

Variant ID: vg0220527488 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20527488
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAAATTTTCGGAGCTATCCGAAAGATTTTCGGAATTCGAGAAGCAAAATAAGATTCTGTATATTTTTGGAGTTGTCCGAAAATATTTTTCGAAACTTT[C/A]
GAAAATGATAGTGTAGTCATTAAGTTTATGAAATTTTTCGGAGTAGTTCTCTTTTGGAATTTTTGAAAAACGCGTGTAAACTCGGGAAGTTGCAGTGCAA

Reverse complement sequence

TTGCACTGCAACTTCCCGAGTTTACACGCGTTTTTCAAAAATTCCAAAAGAGAACTACTCCGAAAAATTTCATAAACTTAATGACTACACTATCATTTTC[G/T]
AAAGTTTCGAAAAATATTTTCGGACAACTCCAAAAATATACAGAATCTTATTTTGCTTCTCGAATTCCGAAAATCTTTCGGATAGCTCCGAAAATTTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.90% 1.50% 5.69% 49.89% NA
All Indica  2759 27.90% 2.50% 8.74% 60.78% NA
All Japonica  1512 69.10% 0.00% 1.06% 29.83% NA
Aus  269 21.90% 0.00% 2.97% 75.09% NA
Indica I  595 13.30% 10.10% 6.72% 69.92% NA
Indica II  465 23.00% 0.20% 4.52% 72.26% NA
Indica III  913 38.60% 0.00% 10.95% 50.49% NA
Indica Intermediate  786 29.60% 1.10% 10.18% 59.03% NA
Temperate Japonica  767 94.40% 0.00% 0.26% 5.35% NA
Tropical Japonica  504 41.10% 0.00% 2.18% 56.75% NA
Japonica Intermediate  241 47.30% 0.00% 1.24% 51.45% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 0.00% 4.44% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220527488 C -> A LOC_Os02g34310.1 upstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:28.695; most accessible tissue: Callus, score: 84.349 N N N N
vg0220527488 C -> A LOC_Os02g34300.1 downstream_gene_variant ; 527.0bp to feature; MODIFIER silent_mutation Average:28.695; most accessible tissue: Callus, score: 84.349 N N N N
vg0220527488 C -> A LOC_Os02g34300-LOC_Os02g34310 intergenic_region ; MODIFIER silent_mutation Average:28.695; most accessible tissue: Callus, score: 84.349 N N N N
vg0220527488 C -> DEL N N silent_mutation Average:28.695; most accessible tissue: Callus, score: 84.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220527488 NA 8.14E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 4.86E-08 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 1.15E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 1.19E-08 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 4.08E-06 1.04E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 2.97E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 1.37E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 6.65E-06 NA mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 5.76E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 7.12E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 NA 3.78E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 1.40E-06 NA mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 7.58E-07 NA mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220527488 7.58E-07 NA mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251