\
| Variant ID: vg0220527488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20527488 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 195. )
TGCAAATTTTCGGAGCTATCCGAAAGATTTTCGGAATTCGAGAAGCAAAATAAGATTCTGTATATTTTTGGAGTTGTCCGAAAATATTTTTCGAAACTTT[C/A]
GAAAATGATAGTGTAGTCATTAAGTTTATGAAATTTTTCGGAGTAGTTCTCTTTTGGAATTTTTGAAAAACGCGTGTAAACTCGGGAAGTTGCAGTGCAA
TTGCACTGCAACTTCCCGAGTTTACACGCGTTTTTCAAAAATTCCAAAAGAGAACTACTCCGAAAAATTTCATAAACTTAATGACTACACTATCATTTTC[G/T]
AAAGTTTCGAAAAATATTTTCGGACAACTCCAAAAATATACAGAATCTTATTTTGCTTCTCGAATTCCGAAAATCTTTCGGATAGCTCCGAAAATTTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.90% | 1.50% | 5.69% | 49.89% | NA |
| All Indica | 2759 | 27.90% | 2.50% | 8.74% | 60.78% | NA |
| All Japonica | 1512 | 69.10% | 0.00% | 1.06% | 29.83% | NA |
| Aus | 269 | 21.90% | 0.00% | 2.97% | 75.09% | NA |
| Indica I | 595 | 13.30% | 10.10% | 6.72% | 69.92% | NA |
| Indica II | 465 | 23.00% | 0.20% | 4.52% | 72.26% | NA |
| Indica III | 913 | 38.60% | 0.00% | 10.95% | 50.49% | NA |
| Indica Intermediate | 786 | 29.60% | 1.10% | 10.18% | 59.03% | NA |
| Temperate Japonica | 767 | 94.40% | 0.00% | 0.26% | 5.35% | NA |
| Tropical Japonica | 504 | 41.10% | 0.00% | 2.18% | 56.75% | NA |
| Japonica Intermediate | 241 | 47.30% | 0.00% | 1.24% | 51.45% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 4.44% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220527488 | C -> A | LOC_Os02g34310.1 | upstream_gene_variant ; 1984.0bp to feature; MODIFIER | silent_mutation | Average:28.695; most accessible tissue: Callus, score: 84.349 | N | N | N | N |
| vg0220527488 | C -> A | LOC_Os02g34300.1 | downstream_gene_variant ; 527.0bp to feature; MODIFIER | silent_mutation | Average:28.695; most accessible tissue: Callus, score: 84.349 | N | N | N | N |
| vg0220527488 | C -> A | LOC_Os02g34300-LOC_Os02g34310 | intergenic_region ; MODIFIER | silent_mutation | Average:28.695; most accessible tissue: Callus, score: 84.349 | N | N | N | N |
| vg0220527488 | C -> DEL | N | N | silent_mutation | Average:28.695; most accessible tissue: Callus, score: 84.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220527488 | NA | 8.14E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 4.86E-08 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 1.15E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 1.19E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | 4.08E-06 | 1.04E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 2.97E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 1.37E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | 6.65E-06 | NA | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 5.76E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 7.12E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | NA | 3.78E-06 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | 1.40E-06 | NA | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | 7.58E-07 | NA | mr1946_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220527488 | 7.58E-07 | NA | mr1948_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |