Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220486632:

Variant ID: vg0220486632 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20486632
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGTAGCTCGATGTCGCGCACAACCACCTCTTGGGCACCGTGCTGGAGGCCGTGCGGCCTCCCCCTGCTCAGGAACTTCACCTCTCCTACAACTTCAC[T/C]
GGTAAGCAGCCGTCCTGCACACGCATATTGCCCATCGATGGCAATGGTAAGCACTGGAAATTGCCTTGCCTACCCAATTGCCCCACCTAGGGCACGCCGC

Reverse complement sequence

GCGGCGTGCCCTAGGTGGGGCAATTGGGTAGGCAAGGCAATTTCCAGTGCTTACCATTGCCATCGATGGGCAATATGCGTGTGCAGGACGGCTGCTTACC[A/G]
GTGAAGTTGTAGGAGAGGTGAAGTTCCTGAGCAGGGGGAGGCCGCACGGCCTCCAGCACGGTGCCCAAGAGGTGGTTGTGCGCGACATCGAGCTACTCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 0.40% 0.53% 60.43% NA
All Indica  2759 6.20% 0.50% 0.83% 92.42% NA
All Japonica  1512 98.30% 0.00% 0.00% 1.65% NA
Aus  269 5.90% 1.50% 0.00% 92.57% NA
Indica I  595 4.00% 0.70% 1.34% 93.95% NA
Indica II  465 10.80% 1.10% 0.65% 87.53% NA
Indica III  913 4.50% 0.20% 0.44% 94.85% NA
Indica Intermediate  786 7.30% 0.40% 1.02% 91.35% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 95.90% 0.00% 0.00% 4.15% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 65.60% 1.10% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220486632 T -> DEL N N silent_mutation Average:47.404; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0220486632 T -> C LOC_Os02g34250.1 downstream_gene_variant ; 2368.0bp to feature; MODIFIER silent_mutation Average:47.404; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0220486632 T -> C LOC_Os02g34260.1 downstream_gene_variant ; 4481.0bp to feature; MODIFIER silent_mutation Average:47.404; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0220486632 T -> C LOC_Os02g34240-LOC_Os02g34250 intergenic_region ; MODIFIER silent_mutation Average:47.404; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220486632 T C 0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220486632 1.47E-06 1.14E-45 mr1016 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 5.82E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 2.00E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 6.65E-31 mr1546 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 6.44E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.03E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.11E-17 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 3.02E-36 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 9.79E-33 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 6.71E-40 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.36E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 5.60E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 3.47E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 2.96E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.19E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 5.67E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 3.14E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.12E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 1.52E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 5.14E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220486632 NA 5.04E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251