Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220479498:

Variant ID: vg0220479498 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20479498
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATCTGTCCGCAGCCCAACATAACTGTACTCCTACTCTGTAATAAAGAAACTTCTGTTGCTGTGATATTCTGTCTTCCTGTGATACCAGCACTGTTTCCT[A/G]
GGACTGGTATCGATTAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGTTCGGGGCTAGTTCGGGGCGTGACACCGCGAGACAAATTTATTAAGCCTA

Reverse complement sequence

TAGGCTTAATAAATTTGTCTCGCGGTGTCACGCCCCGAACTAGCCCCGAACGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTAATCGATACCAGTCC[T/C]
AGGAAACAGTGCTGGTATCACAGGAAGACAGAATATCACAGCAACAGAAGTTTCTTTATTACAGAGTAGGAGTACAGTTATGTTGGGCTGCGGACAGATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	14.00%	12.06%	11.85%	NA
All Indica	2759	60.50%	1.00%	19.83%	18.74%	NA
All Japonica	1512	66.00%	33.20%	0.46%	0.33%	NA
Aus	269	79.90%	5.20%	2.97%	11.90%	NA
Indica I	595	40.20%	0.20%	25.55%	34.12%	NA
Indica II	465	62.40%	1.10%	18.28%	18.28%	NA
Indica III	913	72.30%	1.10%	14.57%	12.05%	NA
Indica Intermediate	786	60.90%	1.40%	22.52%	15.14%	NA
Temperate Japonica	767	89.70%	9.80%	0.13%	0.39%	NA
Tropical Japonica	504	43.80%	55.40%	0.40%	0.40%	NA
Japonica Intermediate	241	36.90%	61.40%	1.66%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	51.10%	33.30%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220479498	A -> G	LOC_Os02g34240.1	upstream_gene_variant ; 2949.0bp to feature; MODIFIER	silent_mutation	Average:31.698; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0220479498	A -> G	LOC_Os02g34240-LOC_Os02g34250	intergenic_region ; MODIFIER	silent_mutation	Average:31.698; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0220479498	A -> DEL	N	N	silent_mutation	Average:31.698; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220479498	NA	8.19E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	6.35E-06	5.98E-08	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	4.20E-06	2.64E-07	mr1116	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	3.21E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	3.82E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	1.96E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	2.22E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	8.72E-06	2.01E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	4.54E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	5.66E-06	5.66E-06	mr1041_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	7.37E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	2.16E-06	2.16E-06	mr1293_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	3.11E-06	3.11E-06	mr1294_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	1.53E-06	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	4.89E-06	4.89E-06	mr1494_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	1.87E-06	1.87E-06	mr1497_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	6.88E-06	6.88E-06	mr1814_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	4.52E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	8.14E-07	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479498	NA	4.31E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251