\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220479392:

Variant ID: vg0220479392 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20479392
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACGATGAGTTTTAGGGTTTCGGTTTAGTTCCCAAGTCGCGCCTGTGATGATTGGTCCAAGTCTTGGCTTCCGTTTTCCCTTTTGTAATGCAGTTGTGA[G/A]
CTCGGGATCTGTCCGCAGCCCAACATAACTGTACTCCTACTCTGTAATAAAGAAACTTCTGTTGCTGTGATATTCTGTCTTCCTGTGATACCAGCACTGT

Reverse complement sequence

ACAGTGCTGGTATCACAGGAAGACAGAATATCACAGCAACAGAAGTTTCTTTATTACAGAGTAGGAGTACAGTTATGTTGGGCTGCGGACAGATCCCGAG[C/T]
TCACAACTGCATTACAAAAGGGAAAACGGAAGCCAAGACTTGGACCAATCATCACAGGCGCGACTTGGGAACTAAACCGAAACCCTAAAACTCATCGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 14.00% 7.91% 53.55% NA
All Indica  2759 4.70% 1.10% 7.72% 86.52% NA
All Japonica  1512 65.10% 33.30% 0.00% 1.65% NA
Aus  269 3.70% 5.20% 57.25% 33.83% NA
Indica I  595 3.50% 0.20% 6.22% 90.08% NA
Indica II  465 8.80% 1.10% 12.26% 77.85% NA
Indica III  913 3.50% 1.20% 5.91% 89.38% NA
Indica Intermediate  786 4.60% 1.50% 8.27% 85.62% NA
Temperate Japonica  767 89.20% 9.80% 0.00% 1.04% NA
Tropical Japonica  504 43.30% 55.40% 0.00% 1.39% NA
Japonica Intermediate  241 34.00% 61.80% 0.00% 4.15% NA
VI/Aromatic  96 4.20% 91.70% 3.12% 1.04% NA
Intermediate  90 32.20% 33.30% 4.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220479392 G -> A LOC_Os02g34240.1 upstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:31.288; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0220479392 G -> A LOC_Os02g34240-LOC_Os02g34250 intergenic_region ; MODIFIER silent_mutation Average:31.288; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0220479392 G -> DEL N N silent_mutation Average:31.288; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220479392 NA 4.89E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 1.67E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 4.27E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 7.23E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 5.53E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 7.44E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 6.03E-07 6.03E-07 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 9.75E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 6.39E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 1.87E-07 1.87E-07 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 2.51E-06 2.51E-06 mr1294_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 3.18E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 4.67E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 4.74E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 2.20E-07 2.20E-07 mr1494_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 1.06E-06 1.06E-06 mr1497_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 2.06E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 3.45E-07 3.45E-07 mr1508_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 2.25E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 2.45E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 8.09E-07 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 9.02E-06 9.02E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 2.92E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 2.73E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 6.99E-07 6.99E-07 mr1814_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 5.39E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 8.93E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 8.37E-07 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 3.90E-07 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220479392 NA 1.01E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251