Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220464869:

Variant ID: vg0220464869 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20464869
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGCACGATAAATTCTTCTAGGGTTTCCCGCGAACCGGTCCTTAATCGCCATGGGCACGACTAGCAAAAA[C/A]
CATGCACCCACAGCCCACCATGTAGTGTATTTTAATTAACTAACACCATTACGGTGCCACTAATCCAAAGCTATACCAATAATCAAAGTCTATGCATTAA

Reverse complement sequence

TTAATGCATAGACTTTGATTATTGGTATAGCTTTGGATTAGTGGCACCGTAATGGTGTTAGTTAATTAAAATACACTACATGGTGGGCTGTGGGTGCATG[G/T]
TTTTTGCTAGTCGTGCCCATGGCGATTAAGGACCGGTTCGCGGGAAACCCTAGAAGAATTTATCGTGCTTACCACAAGCCAGCGTGGGCAACGGCTGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.10%	13.70%	4.97%	54.21%	NA
All Indica	2759	8.40%	1.10%	7.97%	82.46%	NA
All Japonica	1512	66.10%	32.20%	0.07%	1.59%	NA
Aus	269	3.30%	5.20%	4.83%	86.62%	NA
Indica I	595	7.10%	0.20%	4.54%	88.24%	NA
Indica II	465	12.70%	1.30%	7.74%	78.28%	NA
Indica III	913	6.80%	1.30%	9.20%	82.69%	NA
Indica Intermediate	786	8.90%	1.50%	9.29%	80.28%	NA
Temperate Japonica	767	91.40%	7.60%	0.00%	1.04%	NA
Tropical Japonica	504	42.90%	55.80%	0.20%	1.19%	NA
Japonica Intermediate	241	34.40%	61.40%	0.00%	4.15%	NA
VI/Aromatic	96	4.20%	91.70%	1.04%	3.12%	NA
Intermediate	90	40.00%	30.00%	0.00%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220464869	C -> A	LOC_Os02g34210.1	upstream_gene_variant ; 1824.0bp to feature; MODIFIER	silent_mutation	Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0220464869	C -> A	LOC_Os02g34200.1	downstream_gene_variant ; 964.0bp to feature; MODIFIER	silent_mutation	Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0220464869	C -> A	LOC_Os02g34200-LOC_Os02g34210	intergenic_region ; MODIFIER	silent_mutation	Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0220464869	C -> DEL	N	N	silent_mutation	Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220464869	NA	2.32E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	4.75E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	1.57E-06	1.57E-06	mr1041_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	6.14E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	6.31E-07	6.31E-07	mr1293_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	2.17E-06	2.17E-06	mr1294_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	3.84E-06	mr1417_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	3.98E-06	mr1428_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	6.46E-06	mr1467_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	2.56E-06	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	1.21E-06	1.21E-06	mr1494_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	7.92E-07	7.92E-07	mr1497_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	4.31E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	3.89E-06	3.89E-06	mr1508_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	6.00E-09	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	5.52E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	8.89E-06	mr1594_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	6.49E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	4.94E-06	mr1779_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	9.93E-07	9.93E-07	mr1814_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	2.30E-06	2.30E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	3.98E-11	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	4.09E-07	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	1.50E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	1.33E-10	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	5.03E-07	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	2.03E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869	NA	9.79E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251