\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220464869:

Variant ID: vg0220464869 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20464869
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCAGCCGTTGCCCACGCTGGCTTGTGGTAAGCACGATAAATTCTTCTAGGGTTTCCCGCGAACCGGTCCTTAATCGCCATGGGCACGACTAGCAAAAA[C/A]
CATGCACCCACAGCCCACCATGTAGTGTATTTTAATTAACTAACACCATTACGGTGCCACTAATCCAAAGCTATACCAATAATCAAAGTCTATGCATTAA

Reverse complement sequence

TTAATGCATAGACTTTGATTATTGGTATAGCTTTGGATTAGTGGCACCGTAATGGTGTTAGTTAATTAAAATACACTACATGGTGGGCTGTGGGTGCATG[G/T]
TTTTTGCTAGTCGTGCCCATGGCGATTAAGGACCGGTTCGCGGGAAACCCTAGAAGAATTTATCGTGCTTACCACAAGCCAGCGTGGGCAACGGCTGGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.10% 13.70% 4.97% 54.21% NA
All Indica  2759 8.40% 1.10% 7.97% 82.46% NA
All Japonica  1512 66.10% 32.20% 0.07% 1.59% NA
Aus  269 3.30% 5.20% 4.83% 86.62% NA
Indica I  595 7.10% 0.20% 4.54% 88.24% NA
Indica II  465 12.70% 1.30% 7.74% 78.28% NA
Indica III  913 6.80% 1.30% 9.20% 82.69% NA
Indica Intermediate  786 8.90% 1.50% 9.29% 80.28% NA
Temperate Japonica  767 91.40% 7.60% 0.00% 1.04% NA
Tropical Japonica  504 42.90% 55.80% 0.20% 1.19% NA
Japonica Intermediate  241 34.40% 61.40% 0.00% 4.15% NA
VI/Aromatic  96 4.20% 91.70% 1.04% 3.12% NA
Intermediate  90 40.00% 30.00% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220464869 C -> A LOC_Os02g34210.1 upstream_gene_variant ; 1824.0bp to feature; MODIFIER silent_mutation Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0220464869 C -> A LOC_Os02g34200.1 downstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0220464869 C -> A LOC_Os02g34200-LOC_Os02g34210 intergenic_region ; MODIFIER silent_mutation Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0220464869 C -> DEL N N silent_mutation Average:30.868; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220464869 NA 2.32E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 4.75E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 1.57E-06 1.57E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 6.14E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 6.31E-07 6.31E-07 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 2.17E-06 2.17E-06 mr1294_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 3.84E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 3.98E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 6.46E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 2.56E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 1.21E-06 1.21E-06 mr1494_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 7.92E-07 7.92E-07 mr1497_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 4.31E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 3.89E-06 3.89E-06 mr1508_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 6.00E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 5.52E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 8.89E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 6.49E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 4.94E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 9.93E-07 9.93E-07 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 2.30E-06 2.30E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 3.98E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 4.09E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 1.50E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 1.33E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 5.03E-07 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 2.03E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220464869 NA 9.79E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251