\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220457124:

Variant ID: vg0220457124 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20457124
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTAGAGGCCCGATTGAGATAAGTTTAATGCCCGTCACAGATGACACTCTTTTTTGACGGGCTTTTATTAAGGCCCGATAGAGATTACTTGTATGCCC[G/A]
TCACGGTTCATTGTTTTAGGGCCGTTACAGATATTTGTTGCACAGTATAAATACCCCCCCACCACCTAGTGTAACTGTATCCCACTGTTCACTATTTTAG

Reverse complement sequence

CTAAAATAGTGAACAGTGGGATACAGTTACACTAGGTGGTGGGGGGGTATTTATACTGTGCAACAAATATCTGTAACGGCCCTAAAACAATGAACCGTGA[C/T]
GGGCATACAAGTAATCTCTATCGGGCCTTAATAAAAGCCCGTCAAAAAAGAGTGTCATCTGTGACGGGCATTAAACTTATCTCAATCGGGCCTCTAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 14.00% 8.46% 43.38% NA
All Indica  2759 14.10% 1.10% 13.05% 71.77% NA
All Japonica  1512 65.40% 33.00% 0.40% 1.19% NA
Aus  269 72.90% 4.50% 10.78% 11.90% NA
Indica I  595 4.20% 0.00% 2.52% 93.28% NA
Indica II  465 18.30% 1.30% 12.47% 67.96% NA
Indica III  913 17.10% 1.20% 21.14% 60.57% NA
Indica Intermediate  786 15.60% 1.70% 11.96% 70.74% NA
Temperate Japonica  767 89.60% 9.40% 0.00% 1.04% NA
Tropical Japonica  504 43.30% 55.60% 0.79% 0.40% NA
Japonica Intermediate  241 34.90% 61.00% 0.83% 3.32% NA
VI/Aromatic  96 6.20% 91.70% 2.08% 0.00% NA
Intermediate  90 40.00% 34.40% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220457124 G -> A LOC_Os02g34200.1 upstream_gene_variant ; 631.0bp to feature; MODIFIER silent_mutation Average:40.273; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0220457124 G -> A LOC_Os02g34190.1 downstream_gene_variant ; 2519.0bp to feature; MODIFIER silent_mutation Average:40.273; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0220457124 G -> A LOC_Os02g34190-LOC_Os02g34200 intergenic_region ; MODIFIER silent_mutation Average:40.273; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg0220457124 G -> DEL N N silent_mutation Average:40.273; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220457124 NA 1.88E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 8.21E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 9.46E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 1.32E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 2.03E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 9.62E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 8.71E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 2.31E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 1.06E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 9.71E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 1.01E-06 1.01E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 2.90E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 7.13E-06 7.13E-06 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 6.22E-08 6.22E-08 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 8.29E-07 8.29E-07 mr1294_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 2.95E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 3.37E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 5.96E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 3.85E-07 3.85E-07 mr1494_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 4.51E-06 4.51E-06 mr1497_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 9.82E-06 9.81E-06 mr1508_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 3.02E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 5.63E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 3.14E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 6.45E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 5.47E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 1.41E-06 1.41E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 3.53E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 7.97E-06 7.97E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 4.80E-06 4.79E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 1.65E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 3.33E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220457124 NA 1.91E-07 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251