\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220432571:

Variant ID: vg0220432571 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20432571
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTGGTCTTCGGTGATCAGATACGCGAGGCTGCGCATCGACTAACAGACGCAGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCGGACAGAGAGAAG[A/G]
ACGAGTTGTCACTCGCCCTGCAGACTCCAGAGCATCCAGGACGAACACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGAGGGCATCCACAC

Reverse complement sequence

GTGTGGATGCCCTCCTTGAACCCAATCTTCCAAGGAATCACCCCTTTCCCTCGTGTTCGTCCTGGATGCTCTGGAGTCTGCAGGGCGAGTGACAACTCGT[T/C]
CTTCTCTCTGTCCGGTCGGAACGTGCCCTGAGAAGAGGCTTCCACTGCGTCTGTTAGTCGATGCGCAGCCTCGCGTATCTGATCACCGAAGACCAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 14.30% 36.65% 16.23% NA
All Indica  2759 18.70% 2.00% 54.37% 24.90% NA
All Japonica  1512 65.10% 32.10% 2.18% 0.60% NA
Aus  269 3.70% 6.30% 67.29% 22.68% NA
Indica I  595 12.10% 0.70% 40.00% 47.23% NA
Indica II  465 24.90% 1.30% 44.95% 28.82% NA
Indica III  913 20.70% 2.50% 69.88% 6.90% NA
Indica Intermediate  786 17.80% 2.80% 52.80% 26.59% NA
Temperate Japonica  767 89.00% 8.20% 2.35% 0.39% NA
Tropical Japonica  504 43.50% 55.60% 0.79% 0.20% NA
Japonica Intermediate  241 34.40% 58.90% 4.56% 2.07% NA
VI/Aromatic  96 4.20% 91.70% 3.12% 1.04% NA
Intermediate  90 37.80% 35.60% 16.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220432571 A -> G LOC_Os02g34160.1 missense_variant ; p.Asn1182Asp; MODERATE nonsynonymous_codon Average:34.777; most accessible tissue: Minghui63 young leaf, score: 72.959 possibly damaging -1.895 TOLERATED 1.00
vg0220432571 A -> DEL LOC_Os02g34160.1 N frameshift_variant Average:34.777; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220432571 NA 4.21E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.39E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.20E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 9.69E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 3.46E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 3.91E-10 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 9.59E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.19E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.62E-10 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 3.93E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.62E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.38E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 6.14E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.00E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 4.27E-06 4.27E-06 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 3.06E-07 mr1295_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.83E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 6.42E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 2.34E-06 1.75E-08 mr1522_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.89E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.01E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 1.25E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 4.81E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 2.82E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 2.76E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 4.32E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 3.00E-06 mr1817_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220432571 NA 7.15E-08 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251