Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220368674:

Variant ID: vg0220368674 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20368674
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTACATGTGGGCCCCACGTACTTTATTTATTTATTTTTGCTTACTAGGATGCCACGTCAGCGAAACCACCCACATATACTGCCATAGGATCTTGTGTGCA[C/T]
GGTTTATGTAAGTTTAGGGGTACACATTTCTGATTATGTGGTTAATGGGTCTCAAAAAATCTTGCTGTTAAATTGAGGGTGCTCCGGTGAACTTATTGGT

Reverse complement sequence

ACCAATAAGTTCACCGGAGCACCCTCAATTTAACAGCAAGATTTTTTGAGACCCATTAACCACATAATCAGAAATGTGTACCCCTAAACTTACATAAACC[G/A]
TGCACACAAGATCCTATGGCAGTATATGTGGGTGGTTTCGCTGACGTGGCATCCTAGTAAGCAAAAATAAATAAATAAAGTACGTGGGGCCCACATGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.20% 0.19% 0.00% NA
All Indica  2759 96.90% 3.00% 0.11% 0.00% NA
All Japonica  1512 48.20% 51.60% 0.20% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 91.40% 8.20% 0.43% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.20% 0.13% 0.00% NA
Temperate Japonica  767 86.00% 13.80% 0.13% 0.00% NA
Tropical Japonica  504 4.60% 95.20% 0.20% 0.00% NA
Japonica Intermediate  241 19.10% 80.50% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220368674 C -> T LOC_Os02g34070.1 downstream_gene_variant ; 1971.0bp to feature; MODIFIER silent_mutation Average:94.79; most accessible tissue: Zhenshan97 root, score: 99.465 N N N N
vg0220368674 C -> T LOC_Os02g34070-LOC_Os02g34090 intergenic_region ; MODIFIER silent_mutation Average:94.79; most accessible tissue: Zhenshan97 root, score: 99.465 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220368674 C T -0.02 -0.04 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220368674 NA 8.55E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 2.51E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 8.06E-07 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 2.57E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 3.38E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 4.88E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 8.30E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 8.50E-07 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 3.79E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 6.40E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 1.35E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 4.42E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 2.64E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 4.73E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 2.04E-16 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 2.24E-11 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 1.02E-10 mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220368674 NA 4.46E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251