\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220356405:

Variant ID: vg0220356405 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20356405
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTGCTAGACTGATGCAATCTCATTTTCTGTTTGTTTCCTATATGAATTGATCAACTAATCAAGGAAAAGGCCTTTGCATCTTAAAGGAAACAATTGT[G/A]
TTTGGTGTAAAAAGATTCGTGCGGTAGACAATAAATTGCCAACAAATAAACTATCACTAAGGAACCCGTCGAATCAACGAGTACTTAAGTACCAAAGTAT

Reverse complement sequence

ATACTTTGGTACTTAAGTACTCGTTGATTCGACGGGTTCCTTAGTGATAGTTTATTTGTTGGCAATTTATTGTCTACCGCACGAATCTTTTTACACCAAA[C/T]
ACAATTGTTTCCTTTAAGATGCAAAGGCCTTTTCCTTGATTAGTTGATCAATTCATATAGGAAACAAACAGAAAATGAGATTGCATCAGTCTAGCACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 14.60% 0.19% 5.80% NA
All Indica  2759 96.10% 0.80% 0.04% 3.04% NA
All Japonica  1512 63.80% 35.80% 0.33% 0.13% NA
Aus  269 26.00% 5.20% 0.74% 68.03% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.80% 1.10% 0.00% 2.15% NA
Indica III  913 95.70% 0.90% 0.00% 3.40% NA
Indica Intermediate  786 93.10% 1.30% 0.13% 5.47% NA
Temperate Japonica  767 81.70% 17.70% 0.39% 0.13% NA
Tropical Japonica  504 47.40% 52.20% 0.20% 0.20% NA
Japonica Intermediate  241 40.70% 58.90% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 90.60% 1.04% 4.17% NA
Intermediate  90 70.00% 28.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220356405 G -> A LOC_Os02g34060.1 downstream_gene_variant ; 1392.0bp to feature; MODIFIER silent_mutation Average:45.236; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg0220356405 G -> A LOC_Os02g34060-LOC_Os02g34070 intergenic_region ; MODIFIER silent_mutation Average:45.236; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N
vg0220356405 G -> DEL N N silent_mutation Average:45.236; most accessible tissue: Zhenshan97 flower, score: 70.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220356405 9.60E-06 9.60E-06 mr1041_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 8.88E-06 8.88E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 1.17E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 9.39E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 3.60E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 2.54E-07 2.54E-07 mr1293_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 1.43E-06 1.43E-06 mr1294_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 3.28E-06 3.28E-06 mr1494_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 2.13E-06 2.13E-06 mr1497_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 7.34E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 6.76E-06 6.76E-06 mr1747_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 2.21E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 3.85E-06 3.85E-06 mr1814_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 4.28E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 5.15E-06 5.15E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 7.51E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 4.29E-06 4.29E-06 mr1840_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 8.74E-06 8.74E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 2.00E-06 2.00E-06 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 1.63E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 2.19E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220356405 NA 6.47E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251