\
| Variant ID: vg0220337774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20337774 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 103. )
CTGCCCTGCCAGGCTAGGCGAGGCGGGACGAGCGAGCGCGCGCGTGTTTCCCCTCTTCTTTCCACCATACATGCTTCAAGTGGCTAGGAGAGCATCCTCC[C/T]
TTTTAAGTAGGTCCCCCTCTCCTAGAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCTATGAGGTGGGCTTTTGTGATTTTTCAAAGAATTA
TAATTCTTTGAAAAATCACAAAAGCCCACCTCATAGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTACTTAAAA[G/A]
GGAGGATGCTCTCCTAGCCACTTGAAGCATGTATGGTGGAAAGAAGAGGGGAAACACGCGCGCGCTCGCTCGTCCCGCCTCGCCTAGCCTGGCAGGGCAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 37.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220337774 | C -> T | LOC_Os02g34040.1 | downstream_gene_variant ; 694.0bp to feature; MODIFIER | silent_mutation | Average:44.809; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0220337774 | C -> T | LOC_Os02g34030-LOC_Os02g34040 | intergenic_region ; MODIFIER | silent_mutation | Average:44.809; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220337774 | NA | 1.40E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | 5.59E-07 | NA | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | 2.08E-06 | 1.56E-07 | mr1018 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.75E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.03E-10 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.41E-28 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 3.99E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 4.87E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.04E-07 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.30E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 6.21E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.03E-08 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 1.82E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 9.04E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220337774 | NA | 2.19E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |