Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0220330169:

Variant ID: vg0220330169 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20330169
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAGAAATATATAACTGTTAGGCTAGAAAAAGAAAGAAAACACATAATCTCATCGTCGTTTTCACTTAAATAAGTGGACCTAATAATTTAGACCATTCG[A/G]
TTAGATTAGATGTATTTTATTTAAAAATAAACTAATACCTTACTGTTCACCAGAAAAAGAAAACAAAAACAAAAGTATATACTCCATATAGGTACGTACA

Reverse complement sequence

TGTACGTACCTATATGGAGTATATACTTTTGTTTTTGTTTTCTTTTTCTGGTGAACAGTAAGGTATTAGTTTATTTTTAAATAAAATACATCTAATCTAA[T/C]
CGAATGGTCTAAATTATTAGGTCCACTTATTTAAGTGAAAACGACGATGAGATTATGTGTTTTCTTTCTTTTTCTAGCCTAACAGTTATATATTTCTCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.00%	3.70%	1.84%	0.42%	NA
All Indica	2759	99.50%	0.40%	0.07%	0.04%	NA
All Japonica	1512	82.90%	10.80%	5.56%	0.79%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.10%	0.60%	0.00%	0.22%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.80%	0.13%	0.00%	NA
Temperate Japonica	767	69.10%	20.20%	10.69%	0.00%	NA
Tropical Japonica	504	97.00%	0.60%	0.40%	1.98%	NA
Japonica Intermediate	241	97.10%	2.10%	0.00%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	96.70%	1.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220330169	A -> G	LOC_Os02g34030.1	upstream_gene_variant ; 2761.0bp to feature; MODIFIER	silent_mutation	Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0220330169	A -> G	LOC_Os02g34030-LOC_Os02g34040	intergenic_region ; MODIFIER	silent_mutation	Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N
vg0220330169	A -> DEL	N	N	silent_mutation	Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220330169	2.82E-07	4.04E-09	mr1588_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251