\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220330169:

Variant ID: vg0220330169 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20330169
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGAAATATATAACTGTTAGGCTAGAAAAAGAAAGAAAACACATAATCTCATCGTCGTTTTCACTTAAATAAGTGGACCTAATAATTTAGACCATTCG[A/G]
TTAGATTAGATGTATTTTATTTAAAAATAAACTAATACCTTACTGTTCACCAGAAAAAGAAAACAAAAACAAAAGTATATACTCCATATAGGTACGTACA

Reverse complement sequence

TGTACGTACCTATATGGAGTATATACTTTTGTTTTTGTTTTCTTTTTCTGGTGAACAGTAAGGTATTAGTTTATTTTTAAATAAAATACATCTAATCTAA[T/C]
CGAATGGTCTAAATTATTAGGTCCACTTATTTAAGTGAAAACGACGATGAGATTATGTGTTTTCTTTCTTTTTCTAGCCTAACAGTTATATATTTCTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 3.70% 1.84% 0.42% NA
All Indica  2759 99.50% 0.40% 0.07% 0.04% NA
All Japonica  1512 82.90% 10.80% 5.56% 0.79% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.10% 0.60% 0.00% 0.22% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 69.10% 20.20% 10.69% 0.00% NA
Tropical Japonica  504 97.00% 0.60% 0.40% 1.98% NA
Japonica Intermediate  241 97.10% 2.10% 0.00% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 96.70% 1.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220330169 A -> G LOC_Os02g34030.1 upstream_gene_variant ; 2761.0bp to feature; MODIFIER silent_mutation Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0220330169 A -> G LOC_Os02g34030-LOC_Os02g34040 intergenic_region ; MODIFIER silent_mutation Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0220330169 A -> DEL N N silent_mutation Average:28.874; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220330169 2.82E-07 4.04E-09 mr1588_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251