\
| Variant ID: vg0220330014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20330014 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 108. )
TTTCGACTATTTAAAGATAAAACCTATTACTCTATAAATTTAAGCAAATATAGCTATAGATTTTGACTTAAATGGGTGAATCTAATATTTTAAACCATTA[A/G]
ATTAGATGTATATTATTTTAAAAACTAATACCTTATTACTCTGTGTACATAAACGGGAGAAATATATAACTGTTAGGCTAGAAAAAGAAAGAAAACACAT
ATGTGTTTTCTTTCTTTTTCTAGCCTAACAGTTATATATTTCTCCCGTTTATGTACACAGAGTAATAAGGTATTAGTTTTTAAAATAATATACATCTAAT[T/C]
TAATGGTTTAAAATATTAGATTCACCCATTTAAGTCAAAATCTATAGCTATATTTGCTTAAATTTATAGAGTAATAGGTTTTATCTTTAAATAGTCGAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.70% | 18.00% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 3.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 49.80% | 49.30% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 42.00% | 56.30% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220330014 | A -> G | LOC_Os02g34030.1 | upstream_gene_variant ; 2606.0bp to feature; MODIFIER | silent_mutation | Average:26.266; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0220330014 | A -> G | LOC_Os02g34030-LOC_Os02g34040 | intergenic_region ; MODIFIER | silent_mutation | Average:26.266; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220330014 | NA | 4.68E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | NA | 7.57E-06 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | NA | 1.67E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | NA | 1.18E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | 1.41E-07 | NA | mr1622_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | NA | 3.53E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | 8.23E-06 | 8.23E-06 | mr1657_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220330014 | NA | 7.46E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |