Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220319668:

Variant ID: vg0220319668 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20319668
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTCGACGCGTGCATATTGAACGTCATCTTCTTCTTCCTCCTCTTCTAGAGGTATTTCTTGACCTATGCCATGGACGTGCTGGTTGTAATCATCCTCGT[C/T]
TATAATATTGTCTAATCCAACAATTCTCCTTTTCTCTTCACGAACAACATGTAGTTTCTTGTTACACGAGTCAACTATGTAGAACACTTGAACAACTTGT

Reverse complement sequence

ACAAGTTGTTCAAGTGTTCTACATAGTTGACTCGTGTAACAAGAAACTACATGTTGTTCGTGAAGAGAAAAGGAGAATTGTTGGATTAGACAATATTATA[G/A]
ACGAGGATGATTACAACCAGCACGTCCATGGCATAGGTCAAGAAATACCTCTAGAAGAGGAGGAAGAAGAAGATGACGTTCAATATGCACGCGTCGACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.30%	19.70%	0.02%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	49.70%	50.20%	0.07%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.50%	1.50%	0.00%	0.00%	NA
Temperate Japonica	767	54.50%	45.40%	0.13%	0.00%	NA
Tropical Japonica	504	47.20%	52.80%	0.00%	0.00%	NA
Japonica Intermediate	241	39.80%	60.20%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220319668	C -> T	LOC_Os02g34020.1	missense_variant ; p.Asp537Asn; MODERATE	nonsynonymous_codon ; D537N	Average:25.513; most accessible tissue: Minghui63 young leaf, score: 33.985	benign	0.429	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220319668	3.88E-06	3.88E-06	mr1041_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	NA	8.25E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	NA	6.55E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	1.23E-07	1.23E-07	mr1293_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	1.06E-06	1.06E-06	mr1294_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	8.66E-06	8.66E-06	mr1371_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	3.93E-06	3.93E-06	mr1494_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	3.05E-06	3.05E-06	mr1497_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	8.37E-06	8.37E-06	mr1655_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	4.27E-07	4.27E-07	mr1657_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	9.71E-06	9.71E-06	mr1669_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	9.66E-06	9.65E-06	mr1814_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220319668	NA	2.68E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251