\
| Variant ID: vg0220315567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20315567 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTGTCCTTTACTGTATCGATGGACACCTTGGCATACCCAGCTAGCAGGTCTACGCTGTGGACCTTGTCTGTAACCGAGGGCTTGAAAGCCATGCCCCCA[G/A]
CGACTTCGGGAGCGAAAGTTGGGTGGACCCTCGCCAGTAGGACACACTGTGCTACGCCCTGCATATGTGAAAGTCTGAATTTAATATTGGAACGTGTAAA
TTTACACGTTCCAATATTAAATTCAGACTTTCACATATGCAGGGCGTAGCACAGTGTGTCCTACTGGCGAGGGTCCACCCAACTTTCGCTCCCGAAGTCG[C/T]
TGGGGGCATGGCTTTCAAGCCCTCGGTTACAGACAAGGTCCACAGCGTAGACCTGCTAGCTGGGTATGCCAAGGTGTCCATCGATACAGTAAAGGACACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 2.30% | 2.09% | 0.55% | NA |
| All Indica | 2759 | 98.60% | 0.10% | 0.54% | 0.69% | NA |
| All Japonica | 1512 | 87.40% | 6.80% | 5.36% | 0.40% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.17% | 0.34% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.43% | 0.43% | NA |
| Indica III | 913 | 97.70% | 0.00% | 0.88% | 1.42% | NA |
| Indica Intermediate | 786 | 99.10% | 0.10% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 77.60% | 13.30% | 8.87% | 0.26% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.40% | 4.15% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220315567 | G -> A | LOC_Os02g34010.1 | missense_variant ; p.Ala359Val; MODERATE | nonsynonymous_codon ; A359V | Average:42.246; most accessible tissue: Minghui63 flag leaf, score: 76.091 | benign |
1.39 |
DELETERIOUS | 0.00 |
| vg0220315567 | G -> DEL | LOC_Os02g34010.1 | N | frameshift_variant | Average:42.246; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220315567 | 3.49E-08 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 3.92E-06 | 4.24E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 1.36E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | NA | 1.12E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 2.28E-06 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | NA | 6.88E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 9.66E-09 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 4.68E-06 | 1.20E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 3.81E-06 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | NA | 3.34E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 1.22E-07 | NA | mr1305_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 1.20E-06 | 1.82E-08 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 1.39E-08 | 2.91E-09 | mr1585_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 1.19E-06 | 6.95E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | 8.34E-08 | NA | mr1672_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220315567 | NA | 8.30E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |