\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220279272:

Variant ID: vg0220279272 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20279272
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGATCTACCATTTTTCTTTTGGTCATTTCGCCATCCGAGTTTGATTAGACTATATAAAATTTGAATTTTAAAATATAAGAAATTCAAATAATTTTTTG[G/A,T]
GTAGTAAATGATTTGAAATGAAAAAAATTGTCTAAAAAAATGTTGTATAACTTATCAAGATCTACAACTTTTGTATTAGTTATTTTTATATATGACTTTG

Reverse complement sequence

CAAAGTCATATATAAAAATAACTAATACAAAAGTTGTAGATCTTGATAAGTTATACAACATTTTTTTAGACAATTTTTTTCATTTCAAATCATTTACTAC[C/T,A]
CAAAAAATTATTTGAATTTCTTATATTTTAAAATTCAAATTTTATATAGTCTAATCAAACTCGGATGGCGAAATGACCAAAAGAAAAATGGTAGATCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 45.40% 0.15% 0.00% NA
All Indica  2759 33.20% 66.50% 0.25% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 57.60% 41.70% 0.67% 0.00% NA
Indica II  465 19.80% 80.00% 0.22% 0.00% NA
Indica III  913 28.00% 71.90% 0.11% 0.00% NA
Indica Intermediate  786 28.60% 71.20% 0.13% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220279272 G -> A LOC_Os02g33980-LOC_Os02g33990 intergenic_region ; MODIFIER silent_mutation Average:20.512; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0220279272 G -> T LOC_Os02g33980-LOC_Os02g33990 intergenic_region ; MODIFIER N Average:20.512; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220279272 NA 8.60E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 1.26E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 7.71E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 8.72E-07 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 2.42E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 1.12E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 1.53E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 4.64E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 5.02E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 7.12E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 7.77E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 3.15E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 7.45E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 3.38E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220279272 NA 5.78E-07 mr1438_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251