Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220269450:

Variant ID: vg0220269450 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20269450
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCATACTACTCCCAATGGTCCTAAATTGATTGGCCATTTTATAACTACTTCCTCCGTTTCACAATGTAAGGCATTCTAGCATTTCCCACATTCATATT[G/A]
ATGTTAATGAATCTAGATAGATATATATGTCTAGATTCATTAACATTAATATGAATATGAGAAATGCTAGAATGACTTACATTGTGAAACGGAGGGAGTA

Reverse complement sequence

TACTCCCTCCGTTTCACAATGTAAGTCATTCTAGCATTTCTCATATTCATATTAATGTTAATGAATCTAGACATATATATCTATCTAGATTCATTAACAT[C/T]
AATATGAATGTGGGAAATGCTAGAATGCCTTACATTGTGAAACGGAGGAAGTAGTTATAAAATGGCCAATCAATTTAGGACCATTGGGAGTAGTATGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	8.80%	15.13%	20.44%	NA
All Indica	2759	46.50%	0.90%	23.45%	29.10%	NA
All Japonica	1512	81.00%	17.50%	0.60%	0.93%	NA
Aus	269	27.10%	5.60%	17.10%	50.19%	NA
Indica I	595	35.80%	0.70%	36.13%	27.39%	NA
Indica II	465	37.40%	0.90%	24.73%	36.99%	NA
Indica III	913	61.80%	1.20%	13.25%	23.77%	NA
Indica Intermediate	786	42.20%	0.90%	24.94%	31.93%	NA
Temperate Japonica	767	79.80%	19.20%	0.39%	0.65%	NA
Tropical Japonica	504	79.80%	19.00%	0.79%	0.40%	NA
Japonica Intermediate	241	87.60%	8.70%	0.83%	2.90%	NA
VI/Aromatic	96	4.20%	93.80%	2.08%	0.00%	NA
Intermediate	90	51.10%	21.10%	12.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220269450	G -> A	LOC_Os02g33980-LOC_Os02g33990	intergenic_region ; MODIFIER	silent_mutation	Average:26.488; most accessible tissue: Callus, score: 70.033	N	N	N	N
vg0220269450	G -> DEL	N	N	silent_mutation	Average:26.488; most accessible tissue: Callus, score: 70.033	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220269450	1.70E-09	NA	mr1210	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	2.37E-07	3.64E-10	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	1.90E-08	NA	mr1305	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	1.79E-06	1.63E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	9.79E-08	4.19E-13	mr1585	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	1.02E-06	5.60E-10	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	2.66E-09	NA	mr1586	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	6.75E-07	1.27E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	NA	5.10E-08	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	4.14E-06	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	NA	1.63E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	1.71E-06	7.61E-12	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220269450	NA	4.05E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251