Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220259816:

Variant ID: vg0220259816 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20259816
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTGCGAATGCGCAAGTACTTTGATGGTGTTTTGTAAACCAACAGTTCGCAGCAGCCTTCGACAAAATATTTGATTGTATACGATGGTTTCTTTCCATC[A/G]
AGAATGTACCAAACTTTTCTAGTGTAATCGTTAGTGTCTCTCCGTAGTTCGGACACTTTTTAATGTCAGGGTAATAATTTAGCACGAAAAAGCGTGGTAG

Reverse complement sequence

CTACCACGCTTTTTCGTGCTAAATTATTACCCTGACATTAAAAAGTGTCCGAACTACGGAGAGACACTAACGATTACACTAGAAAAGTTTGGTACATTCT[T/C]
GATGGAAAGAAACCATCGTATACAATCAAATATTTTGTCGAAGGCTGCTGCGAACTGTTGGTTTACAAAACACCATCAAAGTACTTGCGCATTCGCACGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.10%	0.78%	0.00%	NA
All Indica	2759	99.10%	0.70%	0.25%	0.00%	NA
All Japonica	1512	26.10%	72.00%	1.92%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.30%	0.50%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	99.60%	0.20%	0.22%	0.00%	NA
Indica Intermediate	786	98.60%	1.30%	0.13%	0.00%	NA
Temperate Japonica	767	21.00%	76.80%	2.22%	0.00%	NA
Tropical Japonica	504	28.40%	71.20%	0.40%	0.00%	NA
Japonica Intermediate	241	37.30%	58.50%	4.15%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220259816	A -> G	LOC_Os02g33980.1	downstream_gene_variant ; 1295.0bp to feature; MODIFIER	silent_mutation	Average:45.564; most accessible tissue: Callus, score: 64.039	N	N	N	N
vg0220259816	A -> G	LOC_Os02g33980-LOC_Os02g33990	intergenic_region ; MODIFIER	silent_mutation	Average:45.564; most accessible tissue: Callus, score: 64.039	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220259816	NA	1.36E-14	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	3.63E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	1.16E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	1.44E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	7.94E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	3.72E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	9.19E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	1.47E-06	1.47E-06	mr1622_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	9.16E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220259816	NA	9.89E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251