\
| Variant ID: vg0220225964 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20225964 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 345. )
TATCCTAAAATTAATCGATAAATAGCATTGCCGTACTTTCTTCAAACTCAGTCTCCTTTCAACATTCACCACTATCTTTTCCAGAACCAAGTCCGACAAA[G/T]
AGTGAGCTTTCAGCCATCATCCATCCCTCGTCGTCTAACTCTATCATCTCGCAGCCGATGCATTCCATCCGATATAGACCCATCAGCCTCAGCTGATACA
TGTATCAGCTGAGGCTGATGGGTCTATATCGGATGGAATGCATCGGCTGCGAGATGATAGAGTTAGACGACGAGGGATGGATGATGGCTGAAAGCTCACT[C/A]
TTTGTCGGACTTGGTTCTGGAAAAGATAGTGGTGAATGTTGAAAGGAGACTGAGTTTGAAGAAAGTACGGCAATGCTATTTATCGATTAATTTTAGGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 2.70% | 1.74% | 0.32% | NA |
| All Indica | 2759 | 92.40% | 4.20% | 2.79% | 0.54% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 86.20% | 7.20% | 4.87% | 1.68% | NA |
| Indica II | 465 | 90.30% | 5.60% | 4.09% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 89.90% | 6.00% | 3.44% | 0.64% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220225964 | G -> T | LOC_Os02g33930.1 | upstream_gene_variant ; 1550.0bp to feature; MODIFIER | silent_mutation | Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 | N | N | N | N |
| vg0220225964 | G -> T | LOC_Os02g33944.1 | upstream_gene_variant ; 1062.0bp to feature; MODIFIER | silent_mutation | Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 | N | N | N | N |
| vg0220225964 | G -> T | LOC_Os02g33930-LOC_Os02g33944 | intergenic_region ; MODIFIER | silent_mutation | Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 | N | N | N | N |
| vg0220225964 | G -> DEL | N | N | silent_mutation | Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220225964 | NA | 1.37E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220225964 | NA | 6.14E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220225964 | 1.29E-06 | NA | mr1717_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220225964 | 3.13E-07 | NA | mr1770_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220225964 | 8.79E-07 | NA | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220225964 | 8.79E-07 | NA | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |