\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220225964:

Variant ID: vg0220225964 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20225964
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCTAAAATTAATCGATAAATAGCATTGCCGTACTTTCTTCAAACTCAGTCTCCTTTCAACATTCACCACTATCTTTTCCAGAACCAAGTCCGACAAA[G/T]
AGTGAGCTTTCAGCCATCATCCATCCCTCGTCGTCTAACTCTATCATCTCGCAGCCGATGCATTCCATCCGATATAGACCCATCAGCCTCAGCTGATACA

Reverse complement sequence

TGTATCAGCTGAGGCTGATGGGTCTATATCGGATGGAATGCATCGGCTGCGAGATGATAGAGTTAGACGACGAGGGATGGATGATGGCTGAAAGCTCACT[C/A]
TTTGTCGGACTTGGTTCTGGAAAAGATAGTGGTGAATGTTGAAAGGAGACTGAGTTTGAAGAAAGTACGGCAATGCTATTTATCGATTAATTTTAGGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 2.70% 1.74% 0.32% NA
All Indica  2759 92.40% 4.20% 2.79% 0.54% NA
All Japonica  1512 99.40% 0.50% 0.13% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 86.20% 7.20% 4.87% 1.68% NA
Indica II  465 90.30% 5.60% 4.09% 0.00% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 89.90% 6.00% 3.44% 0.64% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220225964 G -> T LOC_Os02g33930.1 upstream_gene_variant ; 1550.0bp to feature; MODIFIER silent_mutation Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 N N N N
vg0220225964 G -> T LOC_Os02g33944.1 upstream_gene_variant ; 1062.0bp to feature; MODIFIER silent_mutation Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 N N N N
vg0220225964 G -> T LOC_Os02g33930-LOC_Os02g33944 intergenic_region ; MODIFIER silent_mutation Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 N N N N
vg0220225964 G -> DEL N N silent_mutation Average:58.648; most accessible tissue: Zhenshan97 young leaf, score: 90.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220225964 NA 1.37E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220225964 NA 6.14E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220225964 1.29E-06 NA mr1717_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220225964 3.13E-07 NA mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220225964 8.79E-07 NA mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220225964 8.79E-07 NA mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251