Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220199951:

Variant ID: vg0220199951 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 20199951
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGCGTACGGGCCTCTTAAAGGTCCGCACGCGAAAATAGGAGGCCAATTTTTGCAGACGCACACGAAAACGGTTCGTCTGGGAAAATGGGAGCTCCTTGTT[T/C]
AGGAAAATCTTTTGTGTACCAATAGCACCGAGTAGCACACTATGCACCAACCCCTGACAAATATGAGTAAATTGAAGGCAAATGGGTACAAATACAATTT

Reverse complement sequence

AAATTGTATTTGTACCCATTTGCCTTCAATTTACTCATATTTGTCAGGGGTTGGTGCATAGTGTGCTACTCGGTGCTATTGGTACACAAAAGATTTTCCT[A/G]
AACAAGGAGCTCCCATTTTCCCAGACGAACCGTTTTCGTGTGCGTCTGCAAAAATTGGCCTCCTATTTTCGCGTGCGGACCTTTAAGAGGCCCGTACGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	36.00%	0.04%	0.00%	NA
All Indica	2759	93.10%	6.90%	0.07%	0.00%	NA
All Japonica	1512	9.90%	90.10%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	86.70%	13.10%	0.17%	0.00%	NA
Indica II	465	90.50%	9.50%	0.00%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	5.20%	0.13%	0.00%	NA
Temperate Japonica	767	11.90%	88.10%	0.00%	0.00%	NA
Tropical Japonica	504	6.90%	93.10%	0.00%	0.00%	NA
Japonica Intermediate	241	10.00%	90.00%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0220199951	T -> C	LOC_Os02g33890.1	upstream_gene_variant ; 1768.0bp to feature; MODIFIER	silent_mutation	Average:56.625; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0220199951	T -> C	LOC_Os02g33900.1	downstream_gene_variant ; 2982.0bp to feature; MODIFIER	silent_mutation	Average:56.625; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0220199951	T -> C	LOC_Os02g33890-LOC_Os02g33900	intergenic_region ; MODIFIER	silent_mutation	Average:56.625; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0220199951	NA	3.16E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	9.38E-09	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	3.81E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	1.09E-20	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	4.38E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	2.76E-21	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	4.41E-06	1.76E-06	mr1964	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	4.30E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	5.80E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	1.62E-21	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220199951	NA	1.20E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251