\
| Variant ID: vg0220143787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20143787 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 82. )
TTTCTGTAGTGGTGTGTTTTACAAAACCACAACTAAGAAGGTTTACAAAACCGTGCGGTTACCGCACAGTTATCACGGTTATCACGTGTGGTAATCTTTT[C/T]
AGTTTTTGAAACTATGGTATATCACATGGTAACCGTACGGTTTTCACGATAACCACGCGGTTAACATGGTAACTGCCAAACCATGGGGTGGCGATAACCA
TGGTTATCGCCACCCCATGGTTTGGCAGTTACCATGTTAACCGCGTGGTTATCGTGAAAACCGTACGGTTACCATGTGATATACCATAGTTTCAAAAACT[G/A]
AAAAGATTACCACACGTGATAACCGTGATAACTGTGCGGTAACCGCACGGTTTTGTAAACCTTCTTAGTTGTGGTTTTGTAAAACACACCACTACAGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.20% | 39.10% | 1.84% | 5.90% | NA |
| All Indica | 2759 | 78.80% | 8.60% | 2.83% | 9.79% | NA |
| All Japonica | 1512 | 8.50% | 91.20% | 0.20% | 0.13% | NA |
| Aus | 269 | 65.40% | 32.30% | 1.12% | 1.12% | NA |
| Indica I | 595 | 72.90% | 14.80% | 4.54% | 7.73% | NA |
| Indica II | 465 | 75.90% | 12.70% | 2.15% | 9.25% | NA |
| Indica III | 913 | 82.10% | 3.40% | 1.64% | 12.81% | NA |
| Indica Intermediate | 786 | 80.90% | 7.60% | 3.31% | 8.14% | NA |
| Temperate Japonica | 767 | 9.50% | 90.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.50% | 93.30% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 9.10% | 89.60% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 57.80% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220143787 | C -> T | LOC_Os02g33750.1 | upstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:57.466; most accessible tissue: Callus, score: 90.81 | N | N | N | N |
| vg0220143787 | C -> T | LOC_Os02g33770.1 | upstream_gene_variant ; 4079.0bp to feature; MODIFIER | silent_mutation | Average:57.466; most accessible tissue: Callus, score: 90.81 | N | N | N | N |
| vg0220143787 | C -> T | LOC_Os02g33750.2 | upstream_gene_variant ; 3059.0bp to feature; MODIFIER | silent_mutation | Average:57.466; most accessible tissue: Callus, score: 90.81 | N | N | N | N |
| vg0220143787 | C -> T | LOC_Os02g33750-LOC_Os02g33770 | intergenic_region ; MODIFIER | silent_mutation | Average:57.466; most accessible tissue: Callus, score: 90.81 | N | N | N | N |
| vg0220143787 | C -> DEL | N | N | silent_mutation | Average:57.466; most accessible tissue: Callus, score: 90.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220143787 | NA | 5.68E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 8.04E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 7.29E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 4.68E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 6.96E-19 | mr1518 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 7.25E-13 | mr1630 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 1.55E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220143787 | NA | 1.81E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |