\
| Variant ID: vg0220096466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 20096466 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCATCGACGACCCATCCACTACCCCGATTGGCAGGACGGCGGCAACGACATCACTCCCGTGTGGCAATTTGGTGCGGTGGCGGCTCGGTGGCACACGAC[G/A]
GAGTTTCGCGTCGACCCGCGCATCCTCATGACGGCGGCGAGGCGAATTCAACGACGGCAACTGAGACCTCAACAACGGCAACCAAATTGCATCCGGCCAT
ATGGCCGGATGCAATTTGGTTGCCGTTGTTGAGGTCTCAGTTGCCGTCGTTGAATTCGCCTCGCCGCCGTCATGAGGATGCGCGGGTCGACGCGAAACTC[C/T]
GTCGTGTGCCACCGAGCCGCCACCGCACCAAATTGCCACACGGGAGTGATGTCGTTGCCGCCGTCCTGCCAATCGGGGTAGTGGATGGGTCGTCGATGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 5.70% | 6.03% | 12.70% | NA |
| All Indica | 2759 | 68.00% | 2.10% | 10.04% | 19.79% | NA |
| All Japonica | 1512 | 94.00% | 5.00% | 0.07% | 0.86% | NA |
| Aus | 269 | 39.00% | 49.40% | 1.12% | 10.41% | NA |
| Indica I | 595 | 58.80% | 1.20% | 15.97% | 24.03% | NA |
| Indica II | 465 | 58.90% | 0.20% | 9.03% | 31.83% | NA |
| Indica III | 913 | 79.10% | 3.00% | 5.48% | 12.49% | NA |
| Indica Intermediate | 786 | 67.60% | 3.10% | 11.45% | 17.94% | NA |
| Temperate Japonica | 767 | 94.30% | 5.30% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 93.50% | 5.80% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.50% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 93.80% | 1.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 85.60% | 1.10% | 3.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0220096466 | G -> A | LOC_Os02g33690-LOC_Os02g33700 | intergenic_region ; MODIFIER | silent_mutation | Average:42.838; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0220096466 | G -> DEL | N | N | silent_mutation | Average:42.838; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0220096466 | 6.98E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220096466 | NA | 8.86E-07 | mr1743_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220096466 | 6.46E-06 | NA | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0220096466 | NA | 1.99E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |