\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220048340:

Variant ID: vg0220048340 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20048340
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTCTCTTAAAATTCATAACACTACGCCGGATTAGATCACCTTTGACGGACTCGCGCACCATCATCTTTGATGGGTTTGACCCTGATTAGAGATGAAT[T/C]
GTTACTGATGACTACACTCACCCCGTTAATGGCGACAGACACCTCTAATGGGCCCGTATATTTTTGGCTCGTCAAAAGTGAGGATCTCCACAAATCAATA

Reverse complement sequence

TATTGATTTGTGGAGATCCTCACTTTTGACGAGCCAAAAATATACGGGCCCATTAGAGGTGTCTGTCGCCATTAACGGGGTGAGTGTAGTCATCAGTAAC[A/G]
ATTCATCTCTAATCAGGGTCAAACCCATCAAAGATGATGGTGCGCGAGTCCGTCAAAGGTGATCTAATCCGGCGTAGTGTTATGAATTTTAAGAGAGTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.10% 0.91% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 93.80% 3.50% 2.65% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 88.10% 6.90% 4.95% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220048340 T -> C LOC_Os02g33660.1 upstream_gene_variant ; 4921.0bp to feature; MODIFIER silent_mutation Average:66.634; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N
vg0220048340 T -> C LOC_Os02g33660-LOC_Os02g33670 intergenic_region ; MODIFIER silent_mutation Average:66.634; most accessible tissue: Zhenshan97 young leaf, score: 81.6 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220048340 NA 5.21E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 4.19E-06 NA mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 3.56E-06 3.56E-06 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 7.25E-08 1.61E-10 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 2.16E-08 1.21E-10 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 NA 3.95E-07 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 NA 3.24E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 2.76E-06 1.25E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 2.72E-07 4.39E-10 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 8.85E-06 8.85E-06 mr1589 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 3.43E-06 3.43E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 NA 6.27E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 1.23E-06 2.36E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220048340 2.11E-06 7.15E-11 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251