\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220043147:

Variant ID: vg0220043147 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 20043147
Reference Allele: TAlternative Allele: TCCC,C
Primary Allele: TSecondary Allele: TCCC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCAGCGGCGGCCTCCGCGCGTCCGCGCGTGCCGCTCCTCCCCCCGCGCGGATGGCCGACGTCTACCTCCCTAGCATGCAGACGGCCGGCAACCTCCTCC[T/TCCC,C]
CGCGCGCGGCGCTGCCGTCCGGCTGGCGAGCTCCTCATCTGGGATGGGACCCCAACGCCGCCTGGCCGCACATCTCCTGCAACCGCACCAACCACATCAA

Reverse complement sequence

TTGATGTGGTTGGTGCGGTTGCAGGAGATGTGCGGCCAGGCGGCGTTGGGGTCCCATCCCAGATGAGGAGCTCGCCAGCCGGACGGCAGCGCCGCGCGCG[A/GGGA,G]
GGAGGAGGTTGCCGGCCGTCTGCATGCTAGGGAGGTAGACGTCGGCCATCCGCGCGGGGGGAGGAGCGGCACGCGCGGACGCGCGGAGGCCGCCGCTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TCCC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.10% 0.00% 2.54% 23.34% NA
All Indica  2759 56.40% 0.00% 4.10% 39.43% NA
All Japonica  1512 99.50% 0.00% 0.20% 0.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 56.10% 0.00% 8.07% 35.80% NA
Indica II  465 56.30% 0.00% 2.80% 40.86% NA
Indica III  913 51.30% 0.10% 2.19% 46.44% NA
Indica Intermediate  786 62.70% 0.00% 4.07% 33.21% NA
Temperate Japonica  767 99.30% 0.00% 0.26% 0.39% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 0.00% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220043147 T -> TCCC LOC_Os02g33660.1 inframe_insertion ; p.Ala75_Arg76insGly; MODERATE inframe_variant Average:94.395; most accessible tissue: Zhenshan97 flower, score: 98.124 N N N N
vg0220043147 T -> DEL LOC_Os02g33660.1 N frameshift_variant Average:94.395; most accessible tissue: Zhenshan97 flower, score: 98.124 N N N N
vg0220043147 T -> C LOC_Os02g33660.1 missense_variant ; p.Arg76Gly; MODERATE N Average:94.395; most accessible tissue: Zhenshan97 flower, score: 98.124 N N N N
vg0220043147 T -> C LOC_Os02g33650.1 upstream_gene_variant ; 3634.0bp to feature; MODIFIER N Average:94.395; most accessible tissue: Zhenshan97 flower, score: 98.124 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0220043147 T C 0.02 0.01 0.01 0.01 0.01 0.01
vg0220043147 T TCCC 0.23 0.07 0.12 0.07 0.21 0.23

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220043147 1.69E-11 3.72E-09 mr1004 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 5.52E-10 1.98E-07 mr1005 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 3.74E-06 9.63E-06 mr1010 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 8.72E-09 2.01E-06 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 2.26E-07 2.55E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 6.47E-07 NA mr1163 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220043147 7.77E-06 NA mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251