\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0220014490:

Variant ID: vg0220014490 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 20014490
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGTCATCCTCTAAAAAAGCATATCATCTCTCACGTCAAATCTATCTTTCTAAAGTTGGTTCGTCTCAAGCTATCTTATTGGGTCATATGGTAATGTT[A/G]
AATTTTTAGATAAATCTAAGGAAATTATGCATAAGGAAAAATAGTCAAATTATGTAATTTCTATAGACTTCTCAATTATCTGTCTTCAGACAAATCTAGA

Reverse complement sequence

TCTAGATTTGTCTGAAGACAGATAATTGAGAAGTCTATAGAAATTACATAATTTGACTATTTTTCCTTATGCATAATTTCCTTAGATTTATCTAAAAATT[T/C]
AACATTACCATATGACCCAATAAGATAGCTTGAGACGAACCAACTTTAGAAAGATAGATTTGACGTGAGAGATGATATGCTTTTTTAGAGGATGACATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.70% 0.00% 0.00% NA
All Indica  2759 93.80% 6.20% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 73.80% 26.20% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0220014490 A -> G LOC_Os02g33620.1 upstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:52.382; most accessible tissue: Callus, score: 81.223 N N N N
vg0220014490 A -> G LOC_Os02g33610.1 downstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:52.382; most accessible tissue: Callus, score: 81.223 N N N N
vg0220014490 A -> G LOC_Os02g33610.2 downstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:52.382; most accessible tissue: Callus, score: 81.223 N N N N
vg0220014490 A -> G LOC_Os02g33610-LOC_Os02g33620 intergenic_region ; MODIFIER silent_mutation Average:52.382; most accessible tissue: Callus, score: 81.223 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0220014490 NA 5.35E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0220014490 5.00E-06 NA mr1707 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251