Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0219929533:

Variant ID: vg0219929533 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19929533
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:

GACGAGGGATACTTGCGGATCGGATGAGTTAAGTATTGGGGTACGTTGGAACGAGAGTCTACGTAGTACGACATCAAGCAAACAGAAGACAAGGATTATA[C/T]
TAGTTCAGGCCCCTTATCAGGTAATAGCTCTAGTCCAGTTTATATGAGATTGATGACGATGAGAACAGATTACAAAGAGAGTAGTCGAAACAGATAGTAC

Reverse complement sequence

GTACTATCTGTTTCGACTACTCTCTTTGTAATCTGTTCTCATCGTCATCAATCTCATATAAACTGGACTAGAGCTATTACCTGATAAGGGGCCTGAACTA[G/A]
TATAATCCTTGTCTTCTGTTTGCTTGATGTCGTACTACGTAGACTCTCGTTCCAACGTACCCCAATACTTAACTCATCCGATCCGCAAGTATCCCTCGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	3.90%	0.80%	0.00%	NA
All Indica	2759	92.50%	6.20%	1.27%	0.00%	NA
All Japonica	1512	99.50%	0.40%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	86.40%	10.90%	2.69%	0.00%	NA
Indica II	465	91.40%	7.30%	1.29%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	89.70%	8.80%	1.53%	0.00%	NA
Temperate Japonica	767	99.50%	0.40%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219929533	C -> T	LOC_Os02g33500.1	upstream_gene_variant ; 1193.0bp to feature; MODIFIER	silent_mutation	Average:47.735; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N
vg0219929533	C -> T	LOC_Os02g33500-LOC_Os02g33510	intergenic_region ; MODIFIER	silent_mutation	Average:47.735; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219929533	6.63E-08	1.41E-11	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	1.36E-07	9.80E-13	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	2.75E-06	NA	mr1141	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	3.31E-06	NA	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	8.31E-11	7.34E-16	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	1.04E-09	6.50E-16	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	8.39E-08	1.57E-12	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	1.07E-07	3.74E-13	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	6.94E-07	3.01E-10	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219929533	2.50E-06	7.47E-11	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251