\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219890874:

Variant ID: vg0219890874 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19890874
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGGAAGAGGCCGTACGAACACAATTCCCGATTGATATACTCCATATGCACAAACTATGTACATCTCGTCTTAGAAAAAACCAACTTGAACATATATTT[A/G]
TCCAGATTCGTTTCTAACAGTTACTCCCTCCGTTCTATTTTAAATATAGTGATTGTGGGTTTCTATGTCCAATGTTTGATCGTCCGTTTTATTTTAATTT

Reverse complement sequence

AAATTAAAATAAAACGGACGATCAAACATTGGACATAGAAACCCACAATCACTATATTTAAAATAGAACGGAGGGAGTAACTGTTAGAAACGAATCTGGA[T/C]
AAATATATGTTCAAGTTGGTTTTTTCTAAGACGAGATGTACATAGTTTGTGCATATGGAGTATATCAATCGGGAATTGTGTTCGTACGGCCTCTTCCTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.40% 0.34% 0.00% NA
All Indica  2759 90.20% 9.70% 0.11% 0.00% NA
All Japonica  1512 16.10% 83.00% 0.86% 0.00% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 93.10% 6.60% 0.34% 0.00% NA
Indica II  465 84.50% 15.30% 0.22% 0.00% NA
Indica III  913 94.20% 5.80% 0.00% 0.00% NA
Indica Intermediate  786 86.60% 13.40% 0.00% 0.00% NA
Temperate Japonica  767 17.60% 80.80% 1.56% 0.00% NA
Tropical Japonica  504 4.20% 95.80% 0.00% 0.00% NA
Japonica Intermediate  241 36.50% 63.10% 0.41% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 50.00% 50.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219890874 A -> G LOC_Os02g33460.1 upstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0219890874 A -> G LOC_Os02g33450.1 downstream_gene_variant ; 4529.0bp to feature; MODIFIER silent_mutation Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0219890874 A -> G LOC_Os02g33450.2 downstream_gene_variant ; 4529.0bp to feature; MODIFIER silent_mutation Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0219890874 A -> G LOC_Os02g33450-LOC_Os02g33460 intergenic_region ; MODIFIER silent_mutation Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219890874 NA 4.64E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 2.96E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.43E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 8.66E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 3.01E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 2.65E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 3.00E-08 5.99E-10 mr1117 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 5.43E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.81E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 2.52E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.50E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 3.78E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.72E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.86E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.28E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 8.28E-06 NA mr1428 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 4.21E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 5.31E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 3.51E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 9.60E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.93E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 9.45E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 1.18E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 2.85E-06 2.85E-06 mr1866 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 9.61E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 2.25E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 9.61E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219890874 NA 3.44E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251