| Variant ID: vg0219890874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19890874 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )
ACAGGAAGAGGCCGTACGAACACAATTCCCGATTGATATACTCCATATGCACAAACTATGTACATCTCGTCTTAGAAAAAACCAACTTGAACATATATTT[A/G]
TCCAGATTCGTTTCTAACAGTTACTCCCTCCGTTCTATTTTAAATATAGTGATTGTGGGTTTCTATGTCCAATGTTTGATCGTCCGTTTTATTTTAATTT
AAATTAAAATAAAACGGACGATCAAACATTGGACATAGAAACCCACAATCACTATATTTAAAATAGAACGGAGGGAGTAACTGTTAGAAACGAATCTGGA[T/C]
AAATATATGTTCAAGTTGGTTTTTTCTAAGACGAGATGTACATAGTTTGTGCATATGGAGTATATCAATCGGGAATTGTGTTCGTACGGCCTCTTCCTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.40% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 90.20% | 9.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 16.10% | 83.00% | 0.86% | 0.00% | NA |
| Aus | 269 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 84.50% | 15.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 17.60% | 80.80% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.50% | 63.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219890874 | A -> G | LOC_Os02g33460.1 | upstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0219890874 | A -> G | LOC_Os02g33450.1 | downstream_gene_variant ; 4529.0bp to feature; MODIFIER | silent_mutation | Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0219890874 | A -> G | LOC_Os02g33450.2 | downstream_gene_variant ; 4529.0bp to feature; MODIFIER | silent_mutation | Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0219890874 | A -> G | LOC_Os02g33450-LOC_Os02g33460 | intergenic_region ; MODIFIER | silent_mutation | Average:43.381; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219890874 | NA | 4.64E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 2.96E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 1.43E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 8.66E-06 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 3.01E-09 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 2.65E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | 3.00E-08 | 5.99E-10 | mr1117 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 5.43E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 1.81E-11 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219890874 | NA | 2.52E-17 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/