Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219878821:

Variant ID: vg0219878821 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19878821
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CATCCTTGGCGGCAAGTGAGAGGCCGCGGCGACGCTCGCTAGCTAATGACCTGCCACTTGGCCCCTTTTTTTCTTGTTCCTCACAACCTTGGCACGGCCA[T/C]
AGGCAGATCTCACGGTGACAAAAATCGGCACTAGAGGTCGCGGCGGTGGAAATCGACCCTAGAGGCCGAGGCGATGCTCCCTGCGGCGGCACTGGAGGTC

Reverse complement sequence

GACCTCCAGTGCCGCCGCAGGGAGCATCGCCTCGGCCTCTAGGGTCGATTTCCACCGCCGCGACCTCTAGTGCCGATTTTTGTCACCGTGAGATCTGCCT[A/G]
TGGCCGTGCCAAGGTTGTGAGGAACAAGAAAAAAAGGGGCCAAGTGGCAGGTCATTAGCTAGCGAGCGTCGCCGCGGCCTCTCACTTGCCGCCAAGGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.60%	24.50%	1.82%	49.09%	NA
All Indica	2759	7.10%	8.40%	2.65%	81.81%	NA
All Japonica	1512	45.50%	52.60%	0.20%	1.65%	NA
Aus	269	58.00%	34.20%	2.97%	4.83%	NA
Indica I	595	9.40%	7.70%	1.01%	81.85%	NA
Indica II	465	3.20%	15.10%	2.15%	79.57%	NA
Indica III	913	5.10%	4.50%	4.38%	85.98%	NA
Indica Intermediate	786	9.90%	9.70%	2.16%	78.24%	NA
Temperate Japonica	767	56.30%	42.40%	0.26%	1.04%	NA
Tropical Japonica	504	20.80%	77.60%	0.00%	1.59%	NA
Japonica Intermediate	241	62.70%	33.20%	0.41%	3.73%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	32.20%	37.80%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219878821	T -> DEL	N	N	silent_mutation	Average:58.507; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0219878821	T -> C	LOC_Os02g33440.1	upstream_gene_variant ; 98.0bp to feature; MODIFIER	silent_mutation	Average:58.507; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0219878821	T -> C	LOC_Os02g33450.1	upstream_gene_variant ; 3231.0bp to feature; MODIFIER	silent_mutation	Average:58.507; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0219878821	T -> C	LOC_Os02g33450.2	upstream_gene_variant ; 3231.0bp to feature; MODIFIER	silent_mutation	Average:58.507; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0219878821	T -> C	LOC_Os02g33440-LOC_Os02g33450	intergenic_region ; MODIFIER	silent_mutation	Average:58.507; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219878821	NA	8.91E-09	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	3.32E-07	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.44E-06	mr1085	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.93E-11	mr1093	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	3.83E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.96E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	5.20E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.42E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	9.64E-10	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	4.09E-13	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.00E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	9.76E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.22E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.60E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.25E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.07E-10	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.49E-07	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	7.42E-06	mr1590	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.32E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	9.08E-06	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.96E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	1.22E-06	1.22E-06	mr1866	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	6.11E-07	mr1964	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	2.61E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	5.98E-10	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219878821	NA	1.50E-06	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251