\
| Variant ID: vg0219809349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19809349 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 92. )
TGGCCTAATTAGACTATCTTTGTTGCTGCCTTGTTCAAGTTTTAGTGATAATAATAAAGCTTTCGCTGTTTCATCTCATTCTGCTCGTACTGATAATTCT[T/C]
TGTGGCATAATCGTCTTTGTCATGTTAATTACAAATCTATATCTCGTATGATGTCACTAGATTTAATTCCCAAGCATGACACACGAGGTATAAAGTGTGA
TCACACTTTATACCTCGTGTGTCATGCTTGGGAATTAAATCTAGTGACATCATACGAGATATAGATTTGTAATTAACATGACAAAGACGATTATGCCACA[A/G]
AGAATTATCAGTACGAGCAGAATGAGATGAAACAGCGAAAGCTTTATTATTATCACTAAAACTTGAACAAGGCAGCAACAAAGATAGTCTAATTAGGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 11.60% | 7.15% | 0.04% | NA |
| All Indica | 2759 | 68.20% | 19.80% | 11.96% | 0.07% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 0.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 92.40% | 2.40% | 5.21% | 0.00% | NA |
| Indica II | 465 | 63.70% | 19.40% | 16.77% | 0.22% | NA |
| Indica III | 913 | 53.10% | 31.80% | 15.12% | 0.00% | NA |
| Indica Intermediate | 786 | 70.00% | 19.30% | 10.56% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219809349 | T -> DEL | N | N | silent_mutation | Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| vg0219809349 | T -> C | LOC_Os02g33340.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.91; most accessible tissue: Minghui63 flag leaf, score: 40.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219809349 | NA | 4.18E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | NA | 3.96E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | NA | 2.40E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 1.75E-06 | NA | mr1184 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 4.07E-06 | 4.07E-06 | mr1184 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | NA | 5.25E-06 | mr1311 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 5.28E-06 | 1.10E-07 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 4.71E-06 | 4.71E-06 | mr1387 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | NA | 2.85E-06 | mr1520 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 8.91E-06 | NA | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 8.99E-06 | 3.41E-07 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | 2.13E-06 | 2.12E-06 | mr1694 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219809349 | NA | 9.79E-07 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |