\
| Variant ID: vg0219802540 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19802540 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAACCTCCTAGTAATGCATAAGAGCTAGCCAACTACCGGCTTCAATTCATCTATAACCAATCTAATAGCTCATTGCCTATAAGTATATACTACATCACTA[A/G]
TATATGGTCCTACATCTTATACACACAAAACGTATTAAAGTTTGTACTGCAGCTGGCTATAAATTTATAGCCCGTTTTTCTTTTCTTCTTCATATGTGCT
AGCACATATGAAGAAGAAAAGAAAAACGGGCTATAAATTTATAGCCAGCTGCAGTACAAACTTTAATACGTTTTGTGTGTATAAGATGTAGGACCATATA[T/C]
TAGTGATGTAGTATATACTTATAGGCAATGAGCTATTAGATTGGTTATAGATGAATTGAAGCCGGTAGTTGGCTAGCTCTTATGCATTACTAGGAGGTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 7.10% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 2.80% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 6.80% | 1.85% | 0.00% | NA |
| Aus | 269 | 77.70% | 21.20% | 1.12% | 0.00% | NA |
| Indica I | 595 | 91.40% | 7.40% | 1.18% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 2.60% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.20% | 29.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219802540 | A -> G | LOC_Os02g33330.1 | upstream_gene_variant ; 3822.0bp to feature; MODIFIER | silent_mutation | Average:77.409; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0219802540 | A -> G | LOC_Os02g33335.1 | upstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:77.409; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0219802540 | A -> G | LOC_Os02g33335-LOC_Os02g33340 | intergenic_region ; MODIFIER | silent_mutation | Average:77.409; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219802540 | NA | 9.11E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219802540 | 5.72E-07 | 5.72E-07 | mr1193_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219802540 | NA | 2.30E-07 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219802540 | NA | 1.99E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219802540 | NA | 5.18E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219802540 | NA | 2.40E-06 | mr1994_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |