\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219802339:

Variant ID: vg0219802339 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19802339
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGACACCCATTGTGGGCTTGAGTACCTTCATCTAGTTGCTTCAGATTTTGAGGAACTCATCTAAGGGTGTCTATTATTGCGAGCTAAGTTCCTCTACGA[G/A]
TGTCCTCAGTTAGTGAGGACACTCTAGGAGTGGCTCACATTGTGGATGCCCTTAAATTATGTTTACAGCTGACTTATAGTTGTACCCGCTTTGAGAAGTC

Reverse complement sequence

GACTTCTCAAAGCGGGTACAACTATAAGTCAGCTGTAAACATAATTTAAGGGCATCCACAATGTGAGCCACTCCTAGAGTGTCCTCACTAACTGAGGACA[C/T]
TCGTAGAGGAACTTAGCTCGCAATAATAGACACCCTTAGATGAGTTCCTCAAAATCTGAAGCAACTAGATGAAGGTACTCAAGCCCACAATGGGTGTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 16.10% 0.15% 0.00% NA
All Indica  2759 94.80% 5.10% 0.07% 0.00% NA
All Japonica  1512 74.30% 25.40% 0.33% 0.00% NA
Aus  269 52.80% 47.20% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 96.80% 3.10% 0.11% 0.00% NA
Indica Intermediate  786 93.30% 6.60% 0.13% 0.00% NA
Temperate Japonica  767 81.90% 17.50% 0.65% 0.00% NA
Tropical Japonica  504 76.80% 23.20% 0.00% 0.00% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219802339 G -> A LOC_Os02g33330.1 upstream_gene_variant ; 3621.0bp to feature; MODIFIER silent_mutation Average:75.449; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N
vg0219802339 G -> A LOC_Os02g33335.1 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:75.449; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N
vg0219802339 G -> A LOC_Os02g33335-LOC_Os02g33340 intergenic_region ; MODIFIER silent_mutation Average:75.449; most accessible tissue: Zhenshan97 panicle, score: 88.062 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219802339 G A -0.01 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219802339 NA 2.14E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 3.87E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 8.49E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 6.52E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 3.98E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 4.44E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 2.21E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 3.40E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 3.17E-06 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 7.26E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 8.47E-07 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 4.63E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 1.16E-06 1.16E-06 mr1648_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 9.79E-07 9.79E-07 mr1651_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 4.67E-06 4.67E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 1.09E-09 mr1793_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219802339 NA 5.94E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251