Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219801675:

Variant ID: vg0219801675 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19801675
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGAGGCGGGGAAGAGAGGGGGAAAGAGCGGATCTAGCGCCGGCGAGGTGGATGGCGATGAGTGACGGGAGGGAGAAAGTGGGAGAGAGAGAGAGAGGC[G/A]
AGCGGCGGGGCGGCGACGGCACGGCCGTGCCCCGCTTGCTGCTGGCCGTCGGCCCCCTCACGCCGCCGTCCGGGGTCGCCGCCGCCGCATCCGGGGTCAC

Reverse complement sequence

GTGACCCCGGATGCGGCGGCGGCGACCCCGGACGGCGGCGTGAGGGGGCCGACGGCCAGCAGCAAGCGGGGCACGGCCGTGCCGTCGCCGCCCCGCCGCT[C/T]
GCCTCTCTCTCTCTCTCCCACTTTCTCCCTCCCGTCACTCATCGCCATCCACCTCGCCGGCGCTAGATCCGCTCTTTCCCCCTCTCTTCCCCGCCTCTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 47.20% 0.61% 0.00% NA
All Indica  2759 85.60% 13.70% 0.76% 0.00% NA
All Japonica  1512 1.80% 97.90% 0.26% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 80.80% 17.60% 1.51% 0.00% NA
Indica II  465 82.40% 16.80% 0.86% 0.00% NA
Indica III  913 92.80% 7.10% 0.11% 0.00% NA
Indica Intermediate  786 82.70% 16.40% 0.89% 0.00% NA
Temperate Japonica  767 1.30% 98.30% 0.39% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 95.90% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 31.10% 64.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219801675 G -> A LOC_Os02g33335.1 missense_variant ; p.Ser100Leu; MODERATE nonsynonymous_codon ; S100L Average:77.525; most accessible tissue: Zhenshan97 young leaf, score: 91.76 unknown unknown TOLERATED 0.42

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219801675 G A -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219801675 NA 2.08E-35 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 2.30E-22 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 2.15E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.33E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 2.23E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 8.14E-06 mr1138 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.94E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 4.25E-35 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 4.89E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 9.12E-15 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 2.35E-31 mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.59E-31 mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 3.61E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 3.00E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.39E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 2.75E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 5.63E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 4.88E-13 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 4.51E-06 1.40E-06 mr1138_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.22E-37 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.66E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.44E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.11E-20 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.28E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 4.75E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 7.43E-06 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.11E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 5.87E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 1.45E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219801675 NA 6.24E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251