Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219777925:

Variant ID: vg0219777925 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19777925
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGGGGCGTGTCGGGCTGAACAACGTTGATCTCCCGTTCGGTCAACTTTTGCTTTCTCTTGGATTCATAAGCCAGGGGTCCGCCAAAGATGTGGTTGA[G/A]
TTCCTTGCGGTGGTCTTGAAAACCAGTCGGGGCATCATCTTCATCATCCTTTTTCTTTGACGTGCTTTGATCTCCGTCAGAAGTTTTGCATGTGTTCTTG

Reverse complement sequence

CAAGAACACATGCAAAACTTCTGACGGAGATCAAAGCACGTCAAAGAAAAAGGATGATGAAGATGATGCCCCGACTGGTTTTCAAGACCACCGCAAGGAA[C/T]
TCAACCACATCTTTGGCGGACCCCTGGCTTATGAATCCAAGAGAAAGCAAAAGTTGACCGAACGGGAGATCAACGTTGTTCAGCCCGACACGCCCCAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 17.60% 0.00% 0.00% NA
All Indica  2759 93.60% 6.40% 0.00% 0.00% NA
All Japonica  1512 72.50% 27.50% 0.00% 0.00% NA
Aus  269 52.00% 48.00% 0.00% 0.00% NA
Indica I  595 85.70% 14.30% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.40% 0.00% 0.00% NA
Temperate Japonica  767 79.40% 20.60% 0.00% 0.00% NA
Tropical Japonica  504 76.80% 23.20% 0.00% 0.00% NA
Japonica Intermediate  241 41.50% 58.50% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219777925 G -> A LOC_Os02g33280.1 missense_variant ; p.Leu545Phe; MODERATE nonsynonymous_codon ; L545F Average:48.595; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 benign 0.873 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219777925 NA 4.64E-07 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.78E-07 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.32E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.79E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.34E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.17E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.02E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 4.76E-06 NA mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 2.29E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 3.75E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 5.16E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 6.64E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 2.60E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.83E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 7.01E-07 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 2.82E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 5.91E-06 5.91E-06 mr1245_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 8.57E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 4.60E-06 4.60E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 2.58E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 2.48E-06 2.48E-06 mr1371_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 9.15E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 8.62E-06 8.62E-06 mr1445_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 3.97E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 1.52E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 1.02E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 1.36E-06 1.36E-06 mr1648_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 1.16E-06 1.16E-06 mr1652_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 3.86E-07 3.86E-07 mr1655_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 1.31E-06 1.31E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 3.53E-07 3.53E-07 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 6.08E-06 2.50E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 4.28E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 8.72E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 1.68E-06 NA mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219777925 NA 8.33E-06 mr1974_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251