Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219767723:

Variant ID: vg0219767723 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19767723
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CCGACGTCACGGAGGAGAGCTTGAAGGAAATGGTAGCACATGGTGTTCTTCCGGTGAAGGAGATCATTGGATGGCGTCCGGCGTACGGCGAAGCATTTCC[G/A]
ACCCCGGACACACACGAGGTCGTGGTGTTCTCCCATTTCTTTTACGGTGGGTTATCTCTTCCAACCTCAAGATTCTTCCGGGGGATTTTGGGTTTCTATG

Reverse complement sequence

CATAGAAACCCAAAATCCCCCGGAAGAATCTTGAGGTTGGAAGAGATAACCCACCGTAAAAGAAATGGGAGAACACCACGACCTCGTGTGTGTCCGGGGT[C/T]
GGAAATGCTTCGCCGTACGCCGGACGCCATCCAATGATCTCCTTCACCGGAAGAACACCATGTGCTACCATTTCCTTCAAGCTCTCCTCCGTGACGTCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	15.90%	0.49%	0.85%	NA
All Indica	2759	93.80%	5.40%	0.33%	0.54%	NA
All Japonica	1512	72.70%	27.20%	0.07%	0.00%	NA
Aus	269	55.00%	30.90%	4.83%	9.29%	NA
Indica I	595	86.20%	13.40%	0.00%	0.34%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	97.20%	2.30%	0.11%	0.44%	NA
Indica Intermediate	786	92.70%	5.10%	1.02%	1.15%	NA
Temperate Japonica	767	79.70%	20.30%	0.00%	0.00%	NA
Tropical Japonica	504	76.80%	23.00%	0.20%	0.00%	NA
Japonica Intermediate	241	41.90%	58.10%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219767723	G -> A	LOC_Os02g33260.1	synonymous_variant ; p.Pro48Pro; LOW	synonymous_codon	Average:49.98; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N
vg0219767723	G -> DEL	LOC_Os02g33260.1	N	frameshift_variant	Average:49.98; most accessible tissue: Zhenshan97 young leaf, score: 61.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219767723	NA	1.45E-06	mr1095	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	6.70E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	1.84E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	2.17E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	2.65E-06	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	6.06E-06	6.06E-06	mr1184_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	9.14E-06	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	8.77E-06	8.77E-06	mr1278_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	2.71E-06	2.71E-06	mr1311_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	3.73E-06	mr1332_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	5.71E-06	5.71E-06	mr1371_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	2.00E-06	mr1417_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	6.42E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	3.65E-06	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	4.03E-06	NA	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	4.29E-06	4.29E-06	mr1648_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	3.83E-06	3.83E-06	mr1651_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	2.90E-06	2.90E-06	mr1652_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	4.20E-06	4.20E-06	mr1655_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	5.92E-06	5.92E-06	mr1669_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	6.02E-07	6.02E-07	mr1697_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	8.49E-06	mr1706_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	2.22E-06	2.22E-06	mr1756_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	6.96E-06	6.96E-06	mr1822_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	3.27E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723	NA	4.64E-06	mr1974_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251