\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219767723:

Variant ID: vg0219767723 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19767723
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CCGACGTCACGGAGGAGAGCTTGAAGGAAATGGTAGCACATGGTGTTCTTCCGGTGAAGGAGATCATTGGATGGCGTCCGGCGTACGGCGAAGCATTTCC[G/A]
ACCCCGGACACACACGAGGTCGTGGTGTTCTCCCATTTCTTTTACGGTGGGTTATCTCTTCCAACCTCAAGATTCTTCCGGGGGATTTTGGGTTTCTATG

Reverse complement sequence

CATAGAAACCCAAAATCCCCCGGAAGAATCTTGAGGTTGGAAGAGATAACCCACCGTAAAAGAAATGGGAGAACACCACGACCTCGTGTGTGTCCGGGGT[C/T]
GGAAATGCTTCGCCGTACGCCGGACGCCATCCAATGATCTCCTTCACCGGAAGAACACCATGTGCTACCATTTCCTTCAAGCTCTCCTCCGTGACGTCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 15.90% 0.49% 0.85% NA
All Indica  2759 93.80% 5.40% 0.33% 0.54% NA
All Japonica  1512 72.70% 27.20% 0.07% 0.00% NA
Aus  269 55.00% 30.90% 4.83% 9.29% NA
Indica I  595 86.20% 13.40% 0.00% 0.34% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 97.20% 2.30% 0.11% 0.44% NA
Indica Intermediate  786 92.70% 5.10% 1.02% 1.15% NA
Temperate Japonica  767 79.70% 20.30% 0.00% 0.00% NA
Tropical Japonica  504 76.80% 23.00% 0.20% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219767723 G -> A LOC_Os02g33260.1 synonymous_variant ; p.Pro48Pro; LOW synonymous_codon Average:49.98; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N
vg0219767723 G -> DEL LOC_Os02g33260.1 N frameshift_variant Average:49.98; most accessible tissue: Zhenshan97 young leaf, score: 61.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219767723 NA 1.45E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 6.70E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 1.84E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 2.17E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 2.65E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 6.06E-06 6.06E-06 mr1184_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 9.14E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 8.77E-06 8.77E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 2.71E-06 2.71E-06 mr1311_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 3.73E-06 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 5.71E-06 5.71E-06 mr1371_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 2.00E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 6.42E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 3.65E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 4.03E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 4.29E-06 4.29E-06 mr1648_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 3.83E-06 3.83E-06 mr1651_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 2.90E-06 2.90E-06 mr1652_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 4.20E-06 4.20E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 5.92E-06 5.92E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 6.02E-07 6.02E-07 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 8.49E-06 mr1706_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 2.22E-06 2.22E-06 mr1756_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 6.96E-06 6.96E-06 mr1822_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 3.27E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219767723 NA 4.64E-06 mr1974_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251