Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219761806:

Variant ID: vg0219761806 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19761806
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TGAATTATCACTATACTGAAGTGTCTGATAAAAAAATACACTTTTATATATTGTTCTACATCAGGACTCATGATTTACAATGTTAGTAAGTTTTACCACA[A/G]
AATTAAAATTAAAAATAAAGGACATGGTCTTTAATTCCTATATGGAAGTGACTTGATATATTTCTAAGACCACCTCAAAGTTTCATTGTTAAGATTCCTA

Reverse complement sequence

TAGGAATCTTAACAATGAAACTTTGAGGTGGTCTTAGAAATATATCAAGTCACTTCCATATAGGAATTAAAGACCATGTCCTTTATTTTTAATTTTAATT[T/C]
TGTGGTAAAACTTACTAACATTGTAAATCATGAGTCCTGATGTAGAACAATATATAAAAGTGTATTTTTTTATCAGACACTTCAGTATAGTGATAATTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	29.60%	0.91%	0.00%	NA
All Indica	2759	89.80%	9.60%	0.62%	0.00%	NA
All Japonica	1512	42.10%	56.80%	1.06%	0.00%	NA
Aus	269	42.80%	55.00%	2.23%	0.00%	NA
Indica I	595	86.20%	12.60%	1.18%	0.00%	NA
Indica II	465	85.20%	14.00%	0.86%	0.00%	NA
Indica III	913	95.40%	4.50%	0.11%	0.00%	NA
Indica Intermediate	786	88.70%	10.70%	0.64%	0.00%	NA
Temperate Japonica	767	74.30%	24.50%	1.17%	0.00%	NA
Tropical Japonica	504	4.40%	94.40%	1.19%	0.00%	NA
Japonica Intermediate	241	18.70%	80.90%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	55.60%	40.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219761806	A -> G	LOC_Os02g33240.1	upstream_gene_variant ; 2442.0bp to feature; MODIFIER	silent_mutation	Average:30.832; most accessible tissue: Callus, score: 46.732	N	N	N	N
vg0219761806	A -> G	LOC_Os02g33250.1	downstream_gene_variant ; 3426.0bp to feature; MODIFIER	silent_mutation	Average:30.832; most accessible tissue: Callus, score: 46.732	N	N	N	N
vg0219761806	A -> G	LOC_Os02g33240-LOC_Os02g33250	intergenic_region ; MODIFIER	silent_mutation	Average:30.832; most accessible tissue: Callus, score: 46.732	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219761806	NA	8.33E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219761806	NA	8.43E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219761806	NA	7.67E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	6.51E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	2.72E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	7.23E-07	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	7.45E-09	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	2.98E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	5.69E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	3.71E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	1.63E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	3.47E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	3.49E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	2.20E-06	mr1341_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	3.49E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	1.09E-13	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	8.60E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	2.95E-06	2.95E-06	mr1760_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	8.15E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	4.36E-06	mr1793_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	1.12E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	1.30E-12	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	9.93E-07	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	3.83E-16	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	1.10E-09	mr1864_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	2.25E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219761806	NA	7.07E-08	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251