Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0219673660:

Variant ID: vg0219673660 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19673660
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.43, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTATCAAGATTTACAACTTTTAGTTTGGTCATTTTTCTATATAACATTTTTTTTGAACAGTTTGATTTTGAATTTGAAAATATAACAAATTCAAACAA[T/C]
ATTTTCAAATACTAAATGATTTCAATTGAAAAAGTCATGAACAACAAAGTTGAATAACTGAATAACTCATAGAGATCTAAAACTTTTACTTTTGTTATTT

Reverse complement sequence

AAATAACAAAAGTAAAAGTTTTAGATCTCTATGAGTTATTCAGTTATTCAACTTTGTTGTTCATGACTTTTTCAATTGAAATCATTTAGTATTTGAAAAT[A/G]
TTGTTTGAATTTGTTATATTTTCAAATTCAAAATCAAACTGTTCAAAAAAAATGTTATATAGAAAAATGACCAAACTAAAAGTTGTAAATCTTGATAAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	41.00%	5.06%	0.00%	NA
All Indica	2759	23.20%	68.40%	8.41%	0.00%	NA
All Japonica	1512	98.30%	1.50%	0.20%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	26.40%	68.60%	5.04%	0.00%	NA
Indica II	465	23.00%	64.90%	12.04%	0.00%	NA
Indica III	913	21.60%	68.90%	9.53%	0.00%	NA
Indica Intermediate	786	22.80%	69.70%	7.51%	0.00%	NA
Temperate Japonica	767	98.80%	0.90%	0.26%	0.00%	NA
Tropical Japonica	504	98.60%	1.20%	0.20%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	23.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219673660	T -> C	LOC_Os02g33100-LOC_Os02g33110	intergenic_region ; MODIFIER	silent_mutation	Average:18.071; most accessible tissue: Minghui63 flag leaf, score: 28.781	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219673660	NA	2.85E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	5.60E-19	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	1.99E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	4.22E-10	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	1.66E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	5.01E-06	2.24E-08	mr1341_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	1.63E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660	NA	1.32E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251