\
| Variant ID: vg0219673660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19673660 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.43, others allele: 0.00, population size: 63. )
ACTTATCAAGATTTACAACTTTTAGTTTGGTCATTTTTCTATATAACATTTTTTTTGAACAGTTTGATTTTGAATTTGAAAATATAACAAATTCAAACAA[T/C]
ATTTTCAAATACTAAATGATTTCAATTGAAAAAGTCATGAACAACAAAGTTGAATAACTGAATAACTCATAGAGATCTAAAACTTTTACTTTTGTTATTT
AAATAACAAAAGTAAAAGTTTTAGATCTCTATGAGTTATTCAGTTATTCAACTTTGTTGTTCATGACTTTTTCAATTGAAATCATTTAGTATTTGAAAAT[A/G]
TTGTTTGAATTTGTTATATTTTCAAATTCAAAATCAAACTGTTCAAAAAAAATGTTATATAGAAAAATGACCAAACTAAAAGTTGTAAATCTTGATAAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 41.00% | 5.06% | 0.00% | NA |
| All Indica | 2759 | 23.20% | 68.40% | 8.41% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 26.40% | 68.60% | 5.04% | 0.00% | NA |
| Indica II | 465 | 23.00% | 64.90% | 12.04% | 0.00% | NA |
| Indica III | 913 | 21.60% | 68.90% | 9.53% | 0.00% | NA |
| Indica Intermediate | 786 | 22.80% | 69.70% | 7.51% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 0.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219673660 | T -> C | LOC_Os02g33100-LOC_Os02g33110 | intergenic_region ; MODIFIER | silent_mutation | Average:18.071; most accessible tissue: Minghui63 flag leaf, score: 28.781 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219673660 | NA | 2.85E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 5.60E-19 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 1.99E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 4.22E-10 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 1.66E-17 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | 5.01E-06 | 2.24E-08 | mr1341_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 1.63E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219673660 | NA | 1.32E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |