\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219673660:

Variant ID: vg0219673660 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19673660
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.43, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTATCAAGATTTACAACTTTTAGTTTGGTCATTTTTCTATATAACATTTTTTTTGAACAGTTTGATTTTGAATTTGAAAATATAACAAATTCAAACAA[T/C]
ATTTTCAAATACTAAATGATTTCAATTGAAAAAGTCATGAACAACAAAGTTGAATAACTGAATAACTCATAGAGATCTAAAACTTTTACTTTTGTTATTT

Reverse complement sequence

AAATAACAAAAGTAAAAGTTTTAGATCTCTATGAGTTATTCAGTTATTCAACTTTGTTGTTCATGACTTTTTCAATTGAAATCATTTAGTATTTGAAAAT[A/G]
TTGTTTGAATTTGTTATATTTTCAAATTCAAAATCAAACTGTTCAAAAAAAATGTTATATAGAAAAATGACCAAACTAAAAGTTGTAAATCTTGATAAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 41.00% 5.06% 0.00% NA
All Indica  2759 23.20% 68.40% 8.41% 0.00% NA
All Japonica  1512 98.30% 1.50% 0.20% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 26.40% 68.60% 5.04% 0.00% NA
Indica II  465 23.00% 64.90% 12.04% 0.00% NA
Indica III  913 21.60% 68.90% 9.53% 0.00% NA
Indica Intermediate  786 22.80% 69.70% 7.51% 0.00% NA
Temperate Japonica  767 98.80% 0.90% 0.26% 0.00% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 23.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219673660 T -> C LOC_Os02g33100-LOC_Os02g33110 intergenic_region ; MODIFIER silent_mutation Average:18.071; most accessible tissue: Minghui63 flag leaf, score: 28.781 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219673660 NA 2.85E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 5.60E-19 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 1.99E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 4.22E-10 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 1.66E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 5.01E-06 2.24E-08 mr1341_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 1.63E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219673660 NA 1.32E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251