Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219483986:

Variant ID: vg0219483986 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19483986
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCTTTGCATCATATAGTTTTTACTCCTGTCTGCAACTTTTGTTTTGTCGAGTGTAACATACACATTGGACAGGTTAGGTGTATGCAGATTCAGAACA[A/G]
TTAGCTGCTTAAAACCTTCAAACTCTCGAGGCAAGCTCATGATGCATCTTTCTATCTGTAGATATTCCAAATCACTGGTAGAGAAGAGGCACGATAGAAT

Reverse complement sequence

ATTCTATCGTGCCTCTTCTCTACCAGTGATTTGGAATATCTACAGATAGAAAGATGCATCATGAGCTTGCCTCGAGAGTTTGAAGGTTTTAAGCAGCTAA[T/C]
TGTTCTGAATCTGCATACACCTAACCTGTCCAATGTGTATGTTACACTCGACAAAACAAAAGTTGCAGACAGGAGTAAAAACTATATGATGCAAAGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	4.70%	4.82%	0.00%	NA
All Indica	2759	97.20%	0.30%	2.43%	0.00%	NA
All Japonica	1512	75.90%	14.00%	10.05%	0.00%	NA
Aus	269	96.30%	0.40%	3.35%	0.00%	NA
Indica I	595	91.40%	0.20%	8.40%	0.00%	NA
Indica II	465	98.30%	0.60%	1.08%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.10%	0.50%	1.40%	0.00%	NA
Temperate Japonica	767	57.60%	25.80%	16.56%	0.00%	NA
Tropical Japonica	504	97.20%	0.20%	2.58%	0.00%	NA
Japonica Intermediate	241	89.60%	5.40%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219483986	A -> G	LOC_Os02g32840.1	upstream_gene_variant ; 4202.0bp to feature; MODIFIER	silent_mutation	Average:73.645; most accessible tissue: Zhenshan97 flower, score: 83.605	N	N	N	N
vg0219483986	A -> G	LOC_Os02g32814.1	intron_variant ; MODIFIER	silent_mutation	Average:73.645; most accessible tissue: Zhenshan97 flower, score: 83.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219483986	NA	6.08E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219483986	NA	1.24E-09	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0219483986	NA	4.31E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	3.63E-06	6.16E-08	mr1321_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.41E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	1.45E-07	4.26E-08	mr1332_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	3.33E-07	8.61E-08	mr1332_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	4.08E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.77E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	2.56E-06	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.48E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	5.85E-07	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.46E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	4.46E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	2.76E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.20E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	4.80E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	NA	1.18E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219483986	5.34E-06	6.17E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251