RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0219377038:

Variant ID: vg0219377038 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 19377038
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTGCTTCTGAGGTTCTACATTCGTAGCCTGCTTATAGCTTCTTGGTTTATTTCTTTGGTTTGTTTTGCAGCTCACATTTCTTCGAAGGGATTTCACG[C/T]
TGTCGGCTAGGCTGCGCTACAAGGTAAAGACATTGTTTCTTTCTGTGCCTTACCAGTGCATTGCTTCCTTGCATTTGTGTTTGTCTCCGATGGTTTCTTG

Reverse complement sequence

CAAGAAACCATCGGAGACAAACACAAATGCAAGGAAGCAATGCACTGGTAAGGCACAGAAAGAAACAATGTCTTTACCTTGTAGCGCAGCCTAGCCGACA[G/A]
CGTGAAATCCCTTCGAAGAAATGTGAGCTGCAAAACAAACCAAAGAAATAAACCAAGAAGCTATAAGCAGGCTACGAATGTAGAACCTCAGAAGCAACAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	1.80%	0.89%	0.00%	NA
All Indica	2759	99.60%	0.00%	0.40%	0.00%	NA
All Japonica	1512	92.80%	5.40%	1.85%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	99.30%	0.00%	0.67%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.10%	0.64%	0.00%	NA
Temperate Japonica	767	89.20%	7.40%	3.39%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	89.60%	10.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0219377038	C -> T	LOC_Os02g32660-LOC_Os02g32680	intergenic_region ; MODIFIER	silent_mutation	Average:40.076; most accessible tissue: Callus, score: 94.999	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0219377038	NA	7.14E-06	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	3.79E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	1.54E-06	1.54E-06	mr1160	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	4.27E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	4.53E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	7.47E-07	7.47E-07	mr1609	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	9.41E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	9.29E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	NA	6.63E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219377038	1.51E-06	1.51E-06	mr1191_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0219377038:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact