\
| Variant ID: vg0219377038 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19377038 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTTGCTTCTGAGGTTCTACATTCGTAGCCTGCTTATAGCTTCTTGGTTTATTTCTTTGGTTTGTTTTGCAGCTCACATTTCTTCGAAGGGATTTCACG[C/T]
TGTCGGCTAGGCTGCGCTACAAGGTAAAGACATTGTTTCTTTCTGTGCCTTACCAGTGCATTGCTTCCTTGCATTTGTGTTTGTCTCCGATGGTTTCTTG
CAAGAAACCATCGGAGACAAACACAAATGCAAGGAAGCAATGCACTGGTAAGGCACAGAAAGAAACAATGTCTTTACCTTGTAGCGCAGCCTAGCCGACA[G/A]
CGTGAAATCCCTTCGAAGAAATGTGAGCTGCAAAACAAACCAAAGAAATAAACCAAGAAGCTATAAGCAGGCTACGAATGTAGAACCTCAGAAGCAACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 1.80% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 92.80% | 5.40% | 1.85% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 89.20% | 7.40% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219377038 | C -> T | LOC_Os02g32660-LOC_Os02g32680 | intergenic_region ; MODIFIER | silent_mutation | Average:40.076; most accessible tissue: Callus, score: 94.999 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219377038 | NA | 7.14E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 3.79E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | 1.54E-06 | 1.54E-06 | mr1160 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 4.27E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 4.53E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | 7.47E-07 | 7.47E-07 | mr1609 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 9.41E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 9.29E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | NA | 6.63E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219377038 | 1.51E-06 | 1.51E-06 | mr1191_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |