\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219352023:

Variant ID: vg0219352023 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 19352023
Reference Allele: GAAlternative Allele: AA,GAA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCTCCGTTTTATTATATAAGTTATTTTAACATTTCCTATATTTATATTGATGTTAATGATATATATGTCTAGATTTATTAACATCAATATAAATAT[GA/AA,GAA,G]
AAAAATAATAGAATAAATTATATTATGAAACGGAGGGAGTAGAAGATACACACGCGTGAACACATGTACACATTGATTCAAAGATACACCACTACACATA

Reverse complement sequence

TATGTGTAGTGGTGTATCTTTGAATCAATGTGTACATGTGTTCACGCGTGTGTATCTTCTACTCCCTCCGTTTCATAATATAATTTATTCTATTATTTTT[TC/TT,TTC,C]
ATATTTATATTGATGTTAATAAATCTAGACATATATATCATTAACATCAATATAAATATAGGAAATGTTAAAATAACTTATATAATAAAACGGAGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 20.10% 0.72% 0.00% GAA: 0.36%; G: 0.04%
All Indica  2759 78.50% 21.10% 0.36% 0.00% NA
All Japonica  1512 76.40% 21.00% 1.52% 0.00% GAA: 1.12%
Aus  269 95.50% 4.10% 0.37% 0.00% NA
Indica I  595 91.40% 8.10% 0.50% 0.00% NA
Indica II  465 91.00% 9.00% 0.00% 0.00% NA
Indica III  913 64.00% 35.50% 0.55% 0.00% NA
Indica Intermediate  786 78.40% 21.40% 0.25% 0.00% NA
Temperate Japonica  767 87.10% 7.80% 2.87% 0.00% GAA: 2.22%
Tropical Japonica  504 72.00% 28.00% 0.00% 0.00% NA
Japonica Intermediate  241 51.50% 48.10% 0.41% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 0.00% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219352023 GA -> G LOC_Os02g32650.1 downstream_gene_variant ; 552.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> G LOC_Os02g32660.1 downstream_gene_variant ; 3724.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> G LOC_Os02g32650.2 downstream_gene_variant ; 603.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> G LOC_Os02g32630-LOC_Os02g32650 intergenic_region ; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> GAA LOC_Os02g32650.1 downstream_gene_variant ; 551.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> GAA LOC_Os02g32660.1 downstream_gene_variant ; 3723.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> GAA LOC_Os02g32650.2 downstream_gene_variant ; 602.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> GAA LOC_Os02g32630-LOC_Os02g32650 intergenic_region ; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> AA LOC_Os02g32650.1 downstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> AA LOC_Os02g32660.1 downstream_gene_variant ; 3725.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> AA LOC_Os02g32650.2 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N
vg0219352023 GA -> AA LOC_Os02g32630-LOC_Os02g32650 intergenic_region ; MODIFIER silent_mutation Average:98.491; most accessible tissue: Callus, score: 99.36 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219352023 GA AA 0.02 0.01 0.01 0.03 0.01 0.02
vg0219352023 GA G 0.1 0.09 0.01 0.04 0.04 0.01
vg0219352023 GA GAA 0.09 0.08 0.06 0.06 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219352023 NA 9.27E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 3.88E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 1.88E-06 1.88E-06 mr1460 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 3.08E-06 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 4.24E-06 4.24E-06 mr1537_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 8.19E-07 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 7.36E-07 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 3.27E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 8.42E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 7.82E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 NA 9.05E-06 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219352023 9.81E-06 9.81E-06 mr1972_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251