| Variant ID: vg0219336460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19336460 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 272. )
TCTTCCACGATGGCTCGTCTTCATCTACACGGATGTTGCGTGTCGTCATCAACATCCTATACCACGCCGTTGTTCATGTGGTGTGTGTTACTCCCCACCC[T/C]
TGGCAAACCGATCCTCTTCTGCAGCAGAACTAGAATTGTTGGTATGTTTCGACCATGTTCTATATATTCGATCTATTCGTGTGTAGATGTCTCGTATACA
TGTATACGAGACATCTACACACGAATAGATCGAATATATAGAACATGGTCGAAACATACCAACAATTCTAGTTCTGCTGCAGAAGAGGATCGGTTTGCCA[A/G]
GGGTGGGGAGTAACACACACCACATGAACAACGGCGTGGTATAGGATGTTGATGACGACACGCAACATCCGTGTAGATGAAGACGAGCCATCGTGGAAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 12.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219336460 | T -> C | LOC_Os02g32610.2 | upstream_gene_variant ; 4326.0bp to feature; MODIFIER | silent_mutation | Average:57.169; most accessible tissue: Callus, score: 79.508 | N | N | N | N |
| vg0219336460 | T -> C | LOC_Os02g32615.1 | upstream_gene_variant ; 2837.0bp to feature; MODIFIER | silent_mutation | Average:57.169; most accessible tissue: Callus, score: 79.508 | N | N | N | N |
| vg0219336460 | T -> C | LOC_Os02g32610.3 | upstream_gene_variant ; 4331.0bp to feature; MODIFIER | silent_mutation | Average:57.169; most accessible tissue: Callus, score: 79.508 | N | N | N | N |
| vg0219336460 | T -> C | LOC_Os02g32610.4 | upstream_gene_variant ; 4331.0bp to feature; MODIFIER | silent_mutation | Average:57.169; most accessible tissue: Callus, score: 79.508 | N | N | N | N |
| vg0219336460 | T -> C | LOC_Os02g32615-LOC_Os02g32620 | intergenic_region ; MODIFIER | silent_mutation | Average:57.169; most accessible tissue: Callus, score: 79.508 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219336460 | NA | 3.70E-06 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 5.16E-06 | mr1460 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | 1.19E-06 | 1.19E-06 | mr1460 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 5.79E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 4.56E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 5.39E-06 | mr1381_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 5.48E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | 6.53E-06 | 6.53E-06 | mr1537_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | 4.79E-06 | 3.45E-08 | mr1661_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 6.58E-07 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 2.38E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219336460 | NA | 1.28E-06 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |