\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219336460:

Variant ID: vg0219336460 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19336460
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCCACGATGGCTCGTCTTCATCTACACGGATGTTGCGTGTCGTCATCAACATCCTATACCACGCCGTTGTTCATGTGGTGTGTGTTACTCCCCACCC[T/C]
TGGCAAACCGATCCTCTTCTGCAGCAGAACTAGAATTGTTGGTATGTTTCGACCATGTTCTATATATTCGATCTATTCGTGTGTAGATGTCTCGTATACA

Reverse complement sequence

TGTATACGAGACATCTACACACGAATAGATCGAATATATAGAACATGGTCGAAACATACCAACAATTCTAGTTCTGCTGCAGAAGAGGATCGGTTTGCCA[A/G]
GGGTGGGGAGTAACACACACCACATGAACAACGGCGTGGTATAGGATGTTGATGACGACACGCAACATCCGTGTAGATGAAGACGAGCCATCGTGGAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 12.40% 0.02% 0.00% NA
All Indica  2759 79.40% 20.60% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 65.70% 34.30% 0.00% 0.00% NA
Indica Intermediate  786 78.50% 21.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219336460 T -> C LOC_Os02g32610.2 upstream_gene_variant ; 4326.0bp to feature; MODIFIER silent_mutation Average:57.169; most accessible tissue: Callus, score: 79.508 N N N N
vg0219336460 T -> C LOC_Os02g32615.1 upstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:57.169; most accessible tissue: Callus, score: 79.508 N N N N
vg0219336460 T -> C LOC_Os02g32610.3 upstream_gene_variant ; 4331.0bp to feature; MODIFIER silent_mutation Average:57.169; most accessible tissue: Callus, score: 79.508 N N N N
vg0219336460 T -> C LOC_Os02g32610.4 upstream_gene_variant ; 4331.0bp to feature; MODIFIER silent_mutation Average:57.169; most accessible tissue: Callus, score: 79.508 N N N N
vg0219336460 T -> C LOC_Os02g32615-LOC_Os02g32620 intergenic_region ; MODIFIER silent_mutation Average:57.169; most accessible tissue: Callus, score: 79.508 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219336460 NA 3.70E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 5.16E-06 mr1460 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 1.19E-06 1.19E-06 mr1460 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 5.79E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 4.56E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 5.39E-06 mr1381_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 5.48E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 6.53E-06 6.53E-06 mr1537_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 4.79E-06 3.45E-08 mr1661_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 6.58E-07 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 2.38E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219336460 NA 1.28E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251