\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219335600:

Variant ID: vg0219335600 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19335600
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTGGCCGCTGGTCGCCCGGCACAACGACGTGGGGAGACCGGAGGCTGGACCATGGGAGCGGCCATGTGGTGGTCGGTGCCCATGGATGCGTAGAGTC[G/A]
TGGAGAGGAGAGGAGAGGAGAGCACATATGATGGCGGTGGCTGTGAGGAGAAGTGCATGGAGGGTTGGAGGCTATGATGATAGGGTTGTTAAGATGCTGA

Reverse complement sequence

TCAGCATCTTAACAACCCTATCATCATAGCCTCCAACCCTCCATGCACTTCTCCTCACAGCCACCGCCATCATATGTGCTCTCCTCTCCTCTCCTCTCCA[C/T]
GACTCTACGCATCCATGGGCACCGACCACCACATGGCCGCTCCCATGGTCCAGCCTCCGGTCTCCCCACGTCGTTGTGCCGGGCGACCAGCGGCCAAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 12.40% 0.00% 0.00% NA
All Indica  2759 79.50% 20.50% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 65.70% 34.30% 0.00% 0.00% NA
Indica Intermediate  786 78.90% 21.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219335600 G -> A LOC_Os02g32610.2 upstream_gene_variant ; 3466.0bp to feature; MODIFIER silent_mutation Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0219335600 G -> A LOC_Os02g32615.1 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0219335600 G -> A LOC_Os02g32610.3 upstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0219335600 G -> A LOC_Os02g32610.4 upstream_gene_variant ; 3471.0bp to feature; MODIFIER silent_mutation Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N
vg0219335600 G -> A LOC_Os02g32615-LOC_Os02g32620 intergenic_region ; MODIFIER silent_mutation Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219335600 NA 8.17E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 6.68E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 6.88E-07 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 5.96E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 2.17E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 3.72E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 2.32E-06 1.17E-06 mr1460 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 1.79E-07 1.79E-07 mr1460 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 2.28E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 2.73E-06 mr1510 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 9.56E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 3.02E-07 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 2.45E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219335600 NA 6.84E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251