\
| Variant ID: vg0219335600 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 19335600 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 126. )
TGCTTGGCCGCTGGTCGCCCGGCACAACGACGTGGGGAGACCGGAGGCTGGACCATGGGAGCGGCCATGTGGTGGTCGGTGCCCATGGATGCGTAGAGTC[G/A]
TGGAGAGGAGAGGAGAGGAGAGCACATATGATGGCGGTGGCTGTGAGGAGAAGTGCATGGAGGGTTGGAGGCTATGATGATAGGGTTGTTAAGATGCTGA
TCAGCATCTTAACAACCCTATCATCATAGCCTCCAACCCTCCATGCACTTCTCCTCACAGCCACCGCCATCATATGTGCTCTCCTCTCCTCTCCTCTCCA[C/T]
GACTCTACGCATCCATGGGCACCGACCACCACATGGCCGCTCCCATGGTCCAGCCTCCGGTCTCCCCACGTCGTTGTGCCGGGCGACCAGCGGCCAAGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 8.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0219335600 | G -> A | LOC_Os02g32610.2 | upstream_gene_variant ; 3466.0bp to feature; MODIFIER | silent_mutation | Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 | N | N | N | N |
| vg0219335600 | G -> A | LOC_Os02g32615.1 | upstream_gene_variant ; 1977.0bp to feature; MODIFIER | silent_mutation | Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 | N | N | N | N |
| vg0219335600 | G -> A | LOC_Os02g32610.3 | upstream_gene_variant ; 3471.0bp to feature; MODIFIER | silent_mutation | Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 | N | N | N | N |
| vg0219335600 | G -> A | LOC_Os02g32610.4 | upstream_gene_variant ; 3471.0bp to feature; MODIFIER | silent_mutation | Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 | N | N | N | N |
| vg0219335600 | G -> A | LOC_Os02g32615-LOC_Os02g32620 | intergenic_region ; MODIFIER | silent_mutation | Average:75.107; most accessible tissue: Zhenshan97 young leaf, score: 89.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0219335600 | NA | 8.17E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 6.68E-07 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 6.88E-07 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 5.96E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 2.17E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 3.72E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | 2.32E-06 | 1.17E-06 | mr1460 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | 1.79E-07 | 1.79E-07 | mr1460 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 2.28E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 2.73E-06 | mr1510 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 9.56E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 3.02E-07 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 2.45E-06 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0219335600 | NA | 6.84E-06 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |