\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219292377:

Variant ID: vg0219292377 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19292377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGGGGACCACGTGGGCCCCACCATTTTTTATTAATTTCTATGTGAAACTGACATGTGGGTCCCACGAGCTTTATTATTTTTCTGGATCGAATTGTCA[C/T]
GTAAGCGCCACGTCAATGCCACGTCAGATTGAGACCAAAACCACCTTCAAAACTGCCGAGGGATCTAATCTGCATCGGTTTTGATAGTTGAGGGACCTGT

Reverse complement sequence

ACAGGTCCCTCAACTATCAAAACCGATGCAGATTAGATCCCTCGGCAGTTTTGAAGGTGGTTTTGGTCTCAATCTGACGTGGCATTGACGTGGCGCTTAC[G/A]
TGACAATTCGATCCAGAAAAATAATAAAGCTCGTGGGACCCACATGTCAGTTTCACATAGAAATTAATAAAAAATGGTGGGGCCCACGTGGTCCCCACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 34.70% 3.07% 1.08% NA
All Indica  2759 38.20% 54.90% 5.11% 1.81% NA
All Japonica  1512 93.70% 6.20% 0.07% 0.07% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 43.90% 51.90% 4.03% 0.17% NA
Indica II  465 32.70% 59.10% 7.10% 1.08% NA
Indica III  913 36.90% 57.40% 2.74% 2.96% NA
Indica Intermediate  786 38.70% 51.70% 7.51% 2.16% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.40% 0.20% 0.20% NA
Japonica Intermediate  241 82.20% 17.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219292377 C -> T LOC_Os02g32570.1 upstream_gene_variant ; 2094.0bp to feature; MODIFIER silent_mutation Average:75.091; most accessible tissue: Minghui63 panicle, score: 94.942 N N N N
vg0219292377 C -> T LOC_Os02g32570.2 upstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:75.091; most accessible tissue: Minghui63 panicle, score: 94.942 N N N N
vg0219292377 C -> T LOC_Os02g32560-LOC_Os02g32570 intergenic_region ; MODIFIER silent_mutation Average:75.091; most accessible tissue: Minghui63 panicle, score: 94.942 N N N N
vg0219292377 C -> DEL N N silent_mutation Average:75.091; most accessible tissue: Minghui63 panicle, score: 94.942 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0219292377 C T -0.02 -0.02 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219292377 4.19E-06 5.58E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 7.59E-06 5.15E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 2.83E-06 4.59E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 NA 5.30E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 4.06E-07 4.05E-07 mr1770 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 3.47E-07 3.47E-07 mr1910 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 NA 4.99E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 NA 7.92E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 4.34E-06 3.29E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 6.41E-08 8.15E-08 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 3.41E-07 2.53E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 7.00E-07 6.65E-07 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 2.59E-07 1.97E-07 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 5.44E-07 6.93E-07 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 3.74E-07 6.42E-07 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 2.04E-07 9.23E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 7.83E-08 4.14E-08 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 1.02E-06 8.40E-07 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 6.66E-07 NA mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 3.02E-06 1.45E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219292377 1.05E-06 1.54E-09 mr1961_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251