\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219185129:

Variant ID: vg0219185129 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19185129
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAAAAGTTACAGAAAAAAATTATAAACCAACGGCTGTGTTTAGTTCACACTGAAATTGGAAATTTGGTTAAAATTGGGACGATGTGATGGAAAAGTTG[A/G]
AAAATTATGTGTGTAGGAAAGTTTTGATGTGATAAAAAAGTTGGAAGTTTGGAAAAAAACTTTAGAACTAAACACGGCCTAACGTATAAGAGTAATCTTT

Reverse complement sequence

AAAGATTACTCTTATACGTTAGGCCGTGTTTAGTTCTAAAGTTTTTTTCCAAACTTCCAACTTTTTTATCACATCAAAACTTTCCTACACACATAATTTT[T/C]
CAACTTTTCCATCACATCGTCCCAATTTTAACCAAATTTCCAATTTCAGTGTGAACTAAACACAGCCGTTGGTTTATAATTTTTTTCTGTAACTTTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 11.60% 1.16% 0.19% NA
All Indica  2759 93.90% 5.10% 0.91% 0.07% NA
All Japonica  1512 71.60% 26.30% 1.72% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.30% 5.00% 2.69% 0.00% NA
Indica II  465 92.50% 7.10% 0.43% 0.00% NA
Indica III  913 93.60% 5.90% 0.22% 0.22% NA
Indica Intermediate  786 96.40% 2.90% 0.64% 0.00% NA
Temperate Japonica  767 54.60% 44.10% 1.17% 0.13% NA
Tropical Japonica  504 94.20% 3.60% 1.79% 0.40% NA
Japonica Intermediate  241 78.40% 17.00% 3.32% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 83.30% 13.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219185129 A -> G LOC_Os02g32440.1 upstream_gene_variant ; 3711.0bp to feature; MODIFIER silent_mutation Average:54.162; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0219185129 A -> G LOC_Os02g32450.1 downstream_gene_variant ; 1196.0bp to feature; MODIFIER silent_mutation Average:54.162; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0219185129 A -> G LOC_Os02g32440-LOC_Os02g32450 intergenic_region ; MODIFIER silent_mutation Average:54.162; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0219185129 A -> DEL N N silent_mutation Average:54.162; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219185129 NA 1.06E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.78E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 8.16E-13 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.81E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.75E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 1.14E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.13E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.56E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 1.29E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.74E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 2.29E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 7.47E-11 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 2.77E-06 2.15E-15 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 4.71E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 5.00E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 1.98E-11 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 4.34E-08 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 3.17E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 4.00E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 1.42E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 1.52E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 8.88E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 5.63E-11 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 NA 2.40E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219185129 9.16E-06 7.12E-09 mr1733_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251