\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0219081199:

Variant ID: vg0219081199 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 19081199
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGGCGGTTTGGACGGCGGTTTCAGCTAACGTGATGCCTGCGTGGCTAATTTGGCTTGGTCTTCATCTGACGTGACATTGACGTGGCGCTTACGTCGT[T/A]
GTTTGATTTGGGAAATAAGAAAAACCGTAGATCTATGTGTCAGTTACGAAAAAATAATTAAGAAATGATGGGCATACGTGGCCCCCAAATGTCATTCTCA

Reverse complement sequence

TGAGAATGACATTTGGGGGCCACGTATGCCCATCATTTCTTAATTATTTTTTCGTAACTGACACATAGATCTACGGTTTTTCTTATTTCCCAAATCAAAC[A/T]
ACGACGTAAGCGCCACGTCAATGTCACGTCAGATGAAGACCAAGCCAAATTAGCCACGCAGGCATCACGTTAGCTGAAACCGCCGTCCAAACCGCCTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 46.90% 0.21% 0.21% NA
All Indica  2759 84.00% 15.50% 0.25% 0.25% NA
All Japonica  1512 4.90% 95.00% 0.07% 0.07% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 65.20% 34.50% 0.34% 0.00% NA
Indica II  465 91.00% 8.40% 0.22% 0.43% NA
Indica III  913 93.80% 6.00% 0.22% 0.00% NA
Indica Intermediate  786 82.80% 16.30% 0.25% 0.64% NA
Temperate Japonica  767 4.20% 95.60% 0.13% 0.13% NA
Tropical Japonica  504 6.00% 94.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 36.70% 58.90% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0219081199 T -> A LOC_Os02g32300.1 upstream_gene_variant ; 3363.0bp to feature; MODIFIER silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0219081199 T -> A LOC_Os02g32320.1 upstream_gene_variant ; 3212.0bp to feature; MODIFIER silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0219081199 T -> A LOC_Os02g32320.2 upstream_gene_variant ; 3212.0bp to feature; MODIFIER silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0219081199 T -> A LOC_Os02g32310.1 downstream_gene_variant ; 2487.0bp to feature; MODIFIER silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0219081199 T -> A LOC_Os02g32310-LOC_Os02g32320 intergenic_region ; MODIFIER silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0219081199 T -> DEL N N silent_mutation Average:61.313; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0219081199 NA 1.11E-06 mr1282 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219081199 3.77E-06 NA mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219081199 3.47E-06 NA mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219081199 NA 8.53E-07 mr1658 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0219081199 NA 2.91E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251