\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218989953:

Variant ID: vg0218989953 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18989953
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TAATATATCACTCCACAAACATTAAAATTCAACTTCTACAAATTGTAACAAAAATAAAAAATAAAACTCAAATTAGTAAGGTATATTTGCAATTATATTT[T/G]
TTATTTTTGTTACAACCTGTAAATGTTGAATCTGAACTTGCATGTTTACAGAGTGAATATTACATATTGATCTATCTTGTCAAAATTTTTTTAAAAAAAA

Reverse complement sequence

TTTTTTTTAAAAAAATTTTGACAAGATAGATCAATATGTAATATTCACTCTGTAAACATGCAAGTTCAGATTCAACATTTACAGGTTGTAACAAAAATAA[A/C]
AAATATAATTGCAAATATACCTTACTAATTTGAGTTTTATTTTTTATTTTTGTTACAATTTGTAGAAGTTGAATTTTAATGTTTGTGGAGTGATATATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 46.80% 0.21% 0.02% NA
All Indica  2759 84.90% 14.80% 0.29% 0.04% NA
All Japonica  1512 4.00% 96.00% 0.07% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 65.70% 33.30% 1.01% 0.00% NA
Indica II  465 90.50% 9.50% 0.00% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 85.50% 14.10% 0.25% 0.13% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 6.70% 93.30% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.60% 0.41% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218989953 T -> G LOC_Os02g32140.1 upstream_gene_variant ; 1098.0bp to feature; MODIFIER silent_mutation Average:35.52; most accessible tissue: Callus, score: 65.341 N N N N
vg0218989953 T -> G LOC_Os02g32130.1 downstream_gene_variant ; 4760.0bp to feature; MODIFIER silent_mutation Average:35.52; most accessible tissue: Callus, score: 65.341 N N N N
vg0218989953 T -> G LOC_Os02g32160.1 downstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:35.52; most accessible tissue: Callus, score: 65.341 N N N N
vg0218989953 T -> G LOC_Os02g32140-LOC_Os02g32160 intergenic_region ; MODIFIER silent_mutation Average:35.52; most accessible tissue: Callus, score: 65.341 N N N N
vg0218989953 T -> DEL N N silent_mutation Average:35.52; most accessible tissue: Callus, score: 65.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218989953 NA 4.64E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 3.00E-06 NA mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 3.88E-06 NA mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 4.65E-06 mr1658 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 2.90E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 9.09E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 1.07E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 1.11E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 4.54E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218989953 NA 6.42E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251