\
| Variant ID: vg0218989953 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18989953 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 112. )
TAATATATCACTCCACAAACATTAAAATTCAACTTCTACAAATTGTAACAAAAATAAAAAATAAAACTCAAATTAGTAAGGTATATTTGCAATTATATTT[T/G]
TTATTTTTGTTACAACCTGTAAATGTTGAATCTGAACTTGCATGTTTACAGAGTGAATATTACATATTGATCTATCTTGTCAAAATTTTTTTAAAAAAAA
TTTTTTTTAAAAAAATTTTGACAAGATAGATCAATATGTAATATTCACTCTGTAAACATGCAAGTTCAGATTCAACATTTACAGGTTGTAACAAAAATAA[A/C]
AAATATAATTGCAAATATACCTTACTAATTTGAGTTTTATTTTTTATTTTTGTTACAATTTGTAGAAGTTGAATTTTAATGTTTGTGGAGTGATATATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 46.80% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 84.90% | 14.80% | 0.29% | 0.04% | NA |
| All Japonica | 1512 | 4.00% | 96.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 18.60% | 81.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.70% | 33.30% | 1.01% | 0.00% | NA |
| Indica II | 465 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.50% | 14.10% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.00% | 94.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 60.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218989953 | T -> G | LOC_Os02g32140.1 | upstream_gene_variant ; 1098.0bp to feature; MODIFIER | silent_mutation | Average:35.52; most accessible tissue: Callus, score: 65.341 | N | N | N | N |
| vg0218989953 | T -> G | LOC_Os02g32130.1 | downstream_gene_variant ; 4760.0bp to feature; MODIFIER | silent_mutation | Average:35.52; most accessible tissue: Callus, score: 65.341 | N | N | N | N |
| vg0218989953 | T -> G | LOC_Os02g32160.1 | downstream_gene_variant ; 4061.0bp to feature; MODIFIER | silent_mutation | Average:35.52; most accessible tissue: Callus, score: 65.341 | N | N | N | N |
| vg0218989953 | T -> G | LOC_Os02g32140-LOC_Os02g32160 | intergenic_region ; MODIFIER | silent_mutation | Average:35.52; most accessible tissue: Callus, score: 65.341 | N | N | N | N |
| vg0218989953 | T -> DEL | N | N | silent_mutation | Average:35.52; most accessible tissue: Callus, score: 65.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218989953 | NA | 4.64E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | 3.00E-06 | NA | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | 3.88E-06 | NA | mr1658 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 4.65E-06 | mr1658 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 2.90E-12 | mr1914 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 9.09E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 1.07E-12 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 1.11E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 4.54E-07 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218989953 | NA | 6.42E-06 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |