\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218947002:

Variant ID: vg0218947002 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18947002
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.17, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAGTAATTATTAATTTTTTCCTATCATTTGATTCATTGTTAAATATACTTATATATATATATAGTTTTATATATTTCACAAAAGTTTTTAAATAAGAC[G/A]
AACGGTCAAACATGTTTAAAAAAATCAACGGCACCAAATATTAAAGGACGGAGGGAGTAGTTCTGATCTGATCAATTGAGTACTCAATTGTGATCTTATG

Reverse complement sequence

CATAAGATCACAATTGAGTACTCAATTGATCAGATCAGAACTACTCCCTCCGTCCTTTAATATTTGGTGCCGTTGATTTTTTTAAACATGTTTGACCGTT[C/T]
GTCTTATTTAAAAACTTTTGTGAAATATATAAAACTATATATATATATAAGTATATTTAACAATGAATCAAATGATAGGAAAAAATTAATAATTACTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 2.70% 6.31% 6.31% NA
All Indica  2759 97.60% 0.50% 1.12% 0.83% NA
All Japonica  1512 57.70% 7.40% 17.06% 17.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 92.50% 1.70% 3.01% 2.80% NA
Indica III  913 98.00% 0.30% 0.88% 0.77% NA
Indica Intermediate  786 98.70% 0.10% 0.76% 0.38% NA
Temperate Japonica  767 91.00% 0.50% 6.00% 2.48% NA
Tropical Japonica  504 11.30% 17.10% 29.76% 41.87% NA
Japonica Intermediate  241 49.00% 9.10% 25.73% 16.18% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 3.30% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218947002 G -> A LOC_Os02g32060-LOC_Os02g32070 intergenic_region ; MODIFIER silent_mutation Average:40.975; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg0218947002 G -> DEL N N silent_mutation Average:40.975; most accessible tissue: Minghui63 root, score: 74.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218947002 NA 3.69E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0218947002 NA 8.02E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 4.09E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 7.81E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.44E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 2.42E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.48E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 2.38E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.78E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.01E-11 mr1563 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 4.48E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 6.13E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 4.98E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 7.52E-14 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.14E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 9.13E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 2.85E-11 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 3.39E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 1.52E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 4.38E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 2.82E-10 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218947002 NA 4.31E-31 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251