\
| Variant ID: vg0218913885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18913885 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.19, others allele: 0.00, population size: 104. )
TTATACTTGGTGATACCATGTGCTTTGCTACGGAATATATGGATGAAAATATGTTTAATATTATAGAAATGATAAATGTTGAAGTATTGTGAAAATGATG[C/T]
GAGGAAGATGATATGATATATGTTGAGCTCTAGTATTATATTTTGCATGATTAGTCATGCTTGTATGATATTTAAAATACTCTATAATAGTAATTGTTAG
CTAACAATTACTATTATAGAGTATTTTAAATATCATACAAGCATGACTAATCATGCAAAATATAATACTAGAGCTCAACATATATCATATCATCTTCCTC[G/A]
CATCATTTTCACAATACTTCAACATTTATCATTTCTATAATATTAAACATATTTTCATCCATATATTCCGTAGCAAAGCACATGGTATCACCAAGTATAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.40% | 47.10% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 83.70% | 15.60% | 0.76% | 0.00% | NA |
| All Japonica | 1512 | 4.10% | 95.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.10% | 29.10% | 0.84% | 0.00% | NA |
| Indica II | 465 | 83.40% | 16.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 92.20% | 7.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 14.50% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.90% | 93.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218913885 | C -> T | LOC_Os02g32030.1 | upstream_gene_variant ; 3049.0bp to feature; MODIFIER | silent_mutation | Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0218913885 | C -> T | LOC_Os02g32009.1 | downstream_gene_variant ; 4318.0bp to feature; MODIFIER | silent_mutation | Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0218913885 | C -> T | LOC_Os02g32020.1 | downstream_gene_variant ; 811.0bp to feature; MODIFIER | silent_mutation | Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| vg0218913885 | C -> T | LOC_Os02g32020-LOC_Os02g32030 | intergenic_region ; MODIFIER | silent_mutation | Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218913885 | NA | 8.27E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 2.68E-08 | mr1610 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 9.92E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 2.97E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 1.88E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 3.33E-08 | mr1733_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218913885 | NA | 1.06E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |