\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218913885:

Variant ID: vg0218913885 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18913885
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, C: 0.19, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTATACTTGGTGATACCATGTGCTTTGCTACGGAATATATGGATGAAAATATGTTTAATATTATAGAAATGATAAATGTTGAAGTATTGTGAAAATGATG[C/T]
GAGGAAGATGATATGATATATGTTGAGCTCTAGTATTATATTTTGCATGATTAGTCATGCTTGTATGATATTTAAAATACTCTATAATAGTAATTGTTAG

Reverse complement sequence

CTAACAATTACTATTATAGAGTATTTTAAATATCATACAAGCATGACTAATCATGCAAAATATAATACTAGAGCTCAACATATATCATATCATCTTCCTC[G/A]
CATCATTTTCACAATACTTCAACATTTATCATTTCTATAATATTAAACATATTTTCATCCATATATTCCGTAGCAAAGCACATGGTATCACCAAGTATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 47.10% 0.49% 0.00% NA
All Indica  2759 83.70% 15.60% 0.76% 0.00% NA
All Japonica  1512 4.10% 95.80% 0.13% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 70.10% 29.10% 0.84% 0.00% NA
Indica II  465 83.40% 16.10% 0.43% 0.00% NA
Indica III  913 92.20% 7.40% 0.33% 0.00% NA
Indica Intermediate  786 84.10% 14.50% 1.40% 0.00% NA
Temperate Japonica  767 1.80% 98.00% 0.13% 0.00% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.20% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218913885 C -> T LOC_Os02g32030.1 upstream_gene_variant ; 3049.0bp to feature; MODIFIER silent_mutation Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0218913885 C -> T LOC_Os02g32009.1 downstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0218913885 C -> T LOC_Os02g32020.1 downstream_gene_variant ; 811.0bp to feature; MODIFIER silent_mutation Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0218913885 C -> T LOC_Os02g32020-LOC_Os02g32030 intergenic_region ; MODIFIER silent_mutation Average:48.877; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218913885 NA 8.27E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 2.68E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 9.92E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 2.97E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 1.88E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 3.33E-08 mr1733_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218913885 NA 1.06E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251