\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0218858392:

Variant ID: vg0218858392 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 18858392
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.39, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGTTTCACCATATATAACATAATGTTTCACTTATTGGTCAACTGGCAACATTTAACCGTCCAATGTTTTGGGGCATCGGACATCCAAAACATCAT[A/G]
AAATAACCTAGTGAAACATCATGAAATACTTATTGGAATATCAAAATAATAATATGTGCAACACCAAGAAAATTAATCACTAAAAAGAATTTTTTAAAAA

Reverse complement sequence

TTTTTAAAAAATTCTTTTTAGTGATTAATTTTCTTGGTGTTGCACATATTATTATTTTGATATTCCAATAAGTATTTCATGATGTTTCACTAGGTTATTT[T/C]
ATGATGTTTTGGATGTCCGATGCCCCAAAACATTGGACGGTTAAATGTTGCCAGTTGACCAATAAGTGAAACATTATGTTATATATGGTGAAACAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.40% 0.30% 0.00% NA
All Indica  2759 79.20% 20.30% 0.43% 0.00% NA
All Japonica  1512 5.40% 94.50% 0.07% 0.00% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 72.90% 26.60% 0.50% 0.00% NA
Indica II  465 62.80% 36.80% 0.43% 0.00% NA
Indica III  913 90.90% 8.90% 0.22% 0.00% NA
Indica Intermediate  786 80.20% 19.20% 0.64% 0.00% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 14.50% 85.50% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0218858392 A -> G LOC_Os02g31920.1 upstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:30.391; most accessible tissue: Callus, score: 46.107 N N N N
vg0218858392 A -> G LOC_Os02g31922.1 upstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:30.391; most accessible tissue: Callus, score: 46.107 N N N N
vg0218858392 A -> G LOC_Os02g31924.1 upstream_gene_variant ; 3013.0bp to feature; MODIFIER silent_mutation Average:30.391; most accessible tissue: Callus, score: 46.107 N N N N
vg0218858392 A -> G LOC_Os02g31926.1 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:30.391; most accessible tissue: Callus, score: 46.107 N N N N
vg0218858392 A -> G LOC_Os02g31910-LOC_Os02g31920 intergenic_region ; MODIFIER silent_mutation Average:30.391; most accessible tissue: Callus, score: 46.107 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0218858392 NA 4.26E-08 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.35E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 3.90E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.80E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 8.98E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.15E-10 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.56E-06 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 2.04E-06 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 2.04E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 9.21E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.32E-11 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 2.22E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.86E-07 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 9.87E-06 1.00E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.90E-09 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.17E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 2.50E-07 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.44E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 8.51E-07 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.96E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 3.52E-08 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 1.79E-06 3.75E-10 mr1257_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.20E-09 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 3.60E-08 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 6.22E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 5.65E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 6.25E-06 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 2.58E-08 mr1599_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.15E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.21E-07 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.50E-13 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 4.33E-06 4.19E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 7.38E-16 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 4.43E-14 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0218858392 NA 1.63E-11 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251