| Variant ID: vg0218857747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 18857747 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 318. )
CTATGGCTCGGACGCGTCCGATGTCTCACCAAATATCGGACGCCCAGCCAGGCAACGAGTACATGTGAGAAAATGCTGCAAATCGGCAGCCTGGCGGATT[G/A]
GACGAACCCTGTCACTGTAACATACATGTCTAGCTGTTTCTTTTCATTCTTTCCACCTCTCTTTGAATAATTTTTCTCCTAAATTACTTATCCGATCTAC
GTAGATCGGATAAGTAATTTAGGAGAAAAATTATTCAAAGAGAGGTGGAAAGAATGAAAAGAAACAGCTAGACATGTATGTTACAGTGACAGGGTTCGTC[C/T]
AATCCGCCAGGCTGCCGATTTGCAGCATTTTCTCACATGTACTCGTTGCCTGGCTGGGCGTCCGATATTTGGTGAGACATCGGACGCGTCCGAGCCATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 8.30% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 83.80% | 13.20% | 2.97% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 83.20% | 13.60% | 3.19% | 0.00% | NA |
| Indica II | 465 | 56.80% | 36.10% | 7.10% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.40% | 14.80% | 3.82% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0218857747 | G -> A | LOC_Os02g31920.1 | upstream_gene_variant ; 1487.0bp to feature; MODIFIER | silent_mutation | Average:58.043; most accessible tissue: Callus, score: 80.995 | N | N | N | N |
| vg0218857747 | G -> A | LOC_Os02g31922.1 | upstream_gene_variant ; 2600.0bp to feature; MODIFIER | silent_mutation | Average:58.043; most accessible tissue: Callus, score: 80.995 | N | N | N | N |
| vg0218857747 | G -> A | LOC_Os02g31924.1 | upstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:58.043; most accessible tissue: Callus, score: 80.995 | N | N | N | N |
| vg0218857747 | G -> A | LOC_Os02g31926.1 | upstream_gene_variant ; 4386.0bp to feature; MODIFIER | silent_mutation | Average:58.043; most accessible tissue: Callus, score: 80.995 | N | N | N | N |
| vg0218857747 | G -> A | LOC_Os02g31910-LOC_Os02g31920 | intergenic_region ; MODIFIER | silent_mutation | Average:58.043; most accessible tissue: Callus, score: 80.995 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0218857747 | NA | 5.53E-06 | mr1036 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 3.17E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | 3.08E-06 | NA | mr1666 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 4.98E-06 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | 5.60E-06 | 8.57E-07 | mr1901 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 4.76E-08 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 9.55E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 3.40E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 2.38E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 2.07E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0218857747 | NA | 5.29E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |